From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1232 [new locus tag: NWMN_RS06960 ]
  • pan locus tag?: SAUPAN003688000
  • symbol: NWMN_1232
  • pan gene symbol?:
  • synonym:
  • product: ABC transporter permease

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1232 [new locus tag: NWMN_RS06960 ]
  • symbol: NWMN_1232
  • product: ABC transporter permease
  • replicon: chromosome
  • strand: +
  • coordinates: 1356447..1357178
  • length: 732
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGATACTAAGTTACTTGAAAATCGAATTTAAAGTTATAATGCGTAAAAAAACAACATTA
    ATATTATCTATTTTATTTCCTGTTATATTCTATATATTATTTACTTCGATATTGGAATTG
    CCGGAAGATGTTAAACCTAAATTTTATAAAGAGTATATGTATAGTATGACGGTTTATAGT
    TTGTTAAGTTTTAGTTTACTAACTTTTCCATTAGATATTATTAATGAAAAACAAAATGAA
    TGGCGCCAAAGATTAATGGTAACACCATTTACTTTTACTAGTTATTATATTTCAAAAGTA
    GTGAAAACTATGCTGCAATTTGCAATAGCGATATTAGTTATTTTTATGGTTGGACATTTT
    TATAAAGGTGTTGCAATGAGTGCAGTTCAATGGTTAGAGTCAGGAATATTTTTATGGTTA
    GGTGCGTCTCTATTAATAACTTTTGGCATATTATTTTCTTTGTTAAATGATATTCAAAAA
    ACAAGTGCTTTAGCTAATATCGTAACAATTGGTTTAGCAGTATTAGGTGGATTGTGGTTT
    CCGATAAACACATTTCCAAATTGGCTTCAACATGTTGCTCATGTTTTACCGAGCTATCAT
    TTGCGTAAACTAGGTGTAGATATTGCTTCAAATCATCATATCAATTTAATATCATTTGCT
    ATAATACTCTTGTATGCTTTAGGGAGTATAATAGCAGTATATTGTATTAGTCATTTTAAA
    AGGGCGGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    732

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1232 [new locus tag: NWMN_RS06960 ]
  • symbol: NWMN_1232
  • description: ABC transporter permease
  • length: 243
  • theoretical pI: 9.7801
  • theoretical MW: 27918.3
  • GRAVY: 0.753498

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter membrane protein (TIGR01247; HMM-score: 26.3)
    ABC transporter efflux protein, DrrB family (TIGR00025; HMM-score: 25.3)
    UnclassifiedRole category not yet assigneddaunorubicin resistance protein C (TIGR01248; HMM-score: 17.8)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 6.3)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 2.1)
  • TheSEED:  
    ABC transporter permease protein 
  • PFAM:
    ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 62.7)
    ABC2_membrane; ABC-2 type transporter (PF01061; HMM-score: 50.6)
    ABC2_membrane_4; ABC-2 family transporter protein (PF12730; HMM-score: 20.1)
    ABC2_membrane_2; ABC-2 family transporter protein (PF12679; HMM-score: 19.2)
    no clan definedTctB; Tripartite tricarboxylate transporter TctB family (PF07331; HMM-score: 14)
    IncD; Inclusion membrane protein D (PF17628; HMM-score: 7.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 6
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.163
    • Ymax_pos: 16
    • Cmax: 0.141
    • Cmax_pos: 47
    • Smax: 0.324
    • Smax_pos: 7
    • Smean: 0.244
    • D: 0.195
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MILSYLKIEFKVIMRKKTTLILSILFPVIFYILFTSILELPEDVKPKFYKEYMYSMTVYSLLSFSLLTFPLDIINEKQNEWRQRLMVTPFTFTSYYISKVVKTMLQFAIAILVIFMVGHFYKGVAMSAVQWLESGIFLWLGASLLITFGILFSLLNDIQKTSALANIVTIGLAVLGGLWFPINTFPNWLQHVAHVLPSYHLRKLGVDIASNHHINLISFAIILLYALGSIIAVYCISHFKRAE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]