From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1298 [new locus tag: NWMN_RS07310 ]
  • pan locus tag?: SAUPAN003795000
  • symbol: NWMN_1298
  • pan gene symbol?: pstA
  • synonym:
  • product: phosphate ABC transporter permease

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1298 [new locus tag: NWMN_RS07310 ]
  • symbol: NWMN_1298
  • product: phosphate ABC transporter permease
  • replicon: chromosome
  • strand: -
  • coordinates: 1429282..1430199
  • length: 918
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGGAAACGACAGATAATAATAGACAATCACTCGTCGATCAACAACTTGTCCAAAAACAT
    TTATCATCCAGAACGGTTAAAAATAAAGTGTTCAAACTCATATTTTTAGCATGTACATTA
    TTAGGACTTGTCGTACTTATTGCGTTGTTAACTCAAACATTGATTAAAGGGGTAAGTCAT
    TTAAATTTACAGTTTTTCACTAATTTTTCTTCTTCAACACCATCTATGGCTGGCGTTAAA
    GGCGCGTTAATCGGTTCACTTTGGTTAATGTTAAGTATCATTCCATTATCAATCATCCTA
    GGAATAGGTACAGCTATATACTTAGAAGAATATGCGAAAAACAACAAATTTACTCAGTTT
    GTTAAAATCAGTATTTCCAATTTAGCTGGTGTACCATCAGTTGTATTTGGGTTATTAGGT
    TATACTTTGTTCGTTGGTGGTGCAGGGATTGAAGCCTTGAAAATGGGTAACAGTATATTG
    GCAGCAGCGCTAACAATGACCTTACTGATATTACCAATTATTATTGTTTCAAGTCAGGAA
    GCAATTAGAGCTGTACCTAACTCAGTACGCGAAGCTTCTTACGGCTTAGGTGCTAATAAA
    TGGCAAACGATAAGACGTGTTGTCTTACCAGCAGCGTTACCTGGTATTTTAACTGGATTC
    ATTTTGTCTCTTTCAAGAGCACTGGGAGAAACAGCGCCACTTGTGCTAATCGGTATACCG
    ACTATATTATTGGCAACACCTAGAAGTATATTGGATCAATTTTCAGCATTACCTATCCAA
    ATATTTACTTGGGCGAAAATGCCTCAAGAAGAATTCCAGAATGTTGCATCGGCAGGCATT
    ATCGTTTTACTAGTTATCTTAATCTTAATGAATGGCGTTGCGATTATTTTACGTAACAAA
    TTTAGTAAAAAATTCTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    918

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1298 [new locus tag: NWMN_RS07310 ]
  • symbol: NWMN_1298
  • description: phosphate ABC transporter permease
  • length: 305
  • theoretical pI: 10.7035
  • theoretical MW: 32870.1
  • GRAVY: 0.751803

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, permease protein PstA (TIGR00974; HMM-score: 303.3)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, permease protein PstC (TIGR02138; HMM-score: 142.3)
    NifC-like ABC-type porter (TIGR01581; HMM-score: 49.9)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, permease protein (TIGR02141; HMM-score: 48.5)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, permease protein CysT (TIGR02139; HMM-score: 48.4)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, permease protein (TIGR00969; HMM-score: 45.1)
    2-aminoethylphosphonate ABC transport system, membrane component PhnV (TIGR03255; HMM-score: 40.5)
    2-aminoethylphosphonate ABC transporter, permease protein (TIGR03226; HMM-score: 33.4)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, permease protein CysW (TIGR02140; HMM-score: 29.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, permease protein (TIGR03262; HMM-score: 22.6)
    choline ABC transporter, permease protein (TIGR03416; HMM-score: 19.2)
    ectoine/hydroxyectoine ABC transporter, permease protein EhuC (TIGR03004; HMM-score: 18.9)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, permease protein (TIGR01183; HMM-score: 17.3)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, permease protein PhnE (TIGR01097; HMM-score: 16.4)
  • TheSEED:  
    Phosphorus MetabolismPhosphorus Metabolism - no subcategoryHigh affinity phosphate transporter and control of PHO regulon Phosphate transport system permease protein PstA (TC 3.A.1.7.1) 
    Phosphorus Metabolism - no subcategoryPhosphate metabolism Phosphate transport system permease protein PstA (TC 3.A.1.7.1) 
  • PFAM:
    BPD_transp_1 (CL0404) BPD_transp_1; Binding-protein-dependent transport system inner membrane component (PF00528; HMM-score: 88.6)
    no clan definedDUF3333; Domain of unknown function (DUF3333) (PF11812; HMM-score: 11.6)
    CrgA; Cell division protein CrgA (PF06781; HMM-score: 10.2)
    Piezo_RRas_bdg; Piezo non-specific cation channel, R-Ras-binding domain (PF12166; HMM-score: 9.8)
    DUF3094; Protein of unknown function (DUF3094) (PF11293; HMM-score: 9.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 6
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.17
    • Ymax_pos: 40
    • Cmax: 0.156
    • Cmax_pos: 58
    • Smax: 0.395
    • Smax_pos: 32
    • Smean: 0.175
    • D: 0.172
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • METTDNNRQSLVDQQLVQKHLSSRTVKNKVFKLIFLACTLLGLVVLIALLTQTLIKGVSHLNLQFFTNFSSSTPSMAGVKGALIGSLWLMLSIIPLSIILGIGTAIYLEEYAKNNKFTQFVKISISNLAGVPSVVFGLLGYTLFVGGAGIEALKMGNSILAAALTMTLLILPIIIVSSQEAIRAVPNSVREASYGLGANKWQTIRRVVLPAALPGILTGFILSLSRALGETAPLVLIGIPTILLATPRSILDQFSALPIQIFTWAKMPQEEFQNVASAGIIVLLVILILMNGVAIILRNKFSKKF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]