From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1479 [new locus tag: NWMN_RS08330 ]
  • pan locus tag?: SAUPAN004159000
  • symbol: NWMN_1479
  • pan gene symbol?: mtaB
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1479 [new locus tag: NWMN_RS08330 ]
  • symbol: NWMN_1479
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1645088..1646434
  • length: 1347
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGTCAACAGTTGCGTTTCACACATTAGGTTGTAAAGTAAACCATTATGAAACTGAAGCA
    ATCTGGCAATTATTTAAAGAAGCAAACTATGAGCGCGTTGACTTTGAAGCGAATGCTGAT
    GTATTTGTTATTAATACTTGTACAGTAACGAATACGGGTGATAAAAAAAGTCGTCAAATA
    ATTAGACGTGCAATAAGACAAAATCCTGATGCTGTAATCTGTGTAACAGGTTGTTATGCG
    CAAACTTCATCAGCTGAAATTATGGAAATTCCTGGTGTCGATGTAGTAGTTGGTACACAA
    GATAGACATAAACTATTAGGTTACATTGACGAATTCCGTAAAGAACGCCAACCAATTAAT
    GGTGTTGGAAATATCATGAAAAATCGTAAATATGAAGAATTAGATGTCCCTTATTTTACA
    GATAGAACACGTGCGTCATTAAAAATTCAAGAAGGTTGTAACAACTTCTGCACATTCTGT
    ATTATTCCATGGGCTCGTGGCTTAATGCGTTCAAGAGATCCGGAAAAAGTAGTTGAACAA
    GCGACGCAACTAGTGAATTCAGGATATAAGGAAATTGTATTGACGGGAATTCATACAGGT
    GGATATGGTCAAGATTTAAAAGATTATAACTTGGCCCAATTATTACGTGATCTTGAAACG
    ATTAATGGATTAGAACGAATTCGAATTTCTTCAATTGAAGCAAGTCAACTTACAGATGAA
    GTAATTGACGTTTTAGAACGTTCAACAAAAGTTGTGCGTCATTTGCATATTCCATTACAA
    TCTGGTTCAGATACAGTATTAAAACGTATGAGACGTAAGTATACAATGGATAGATTTTCA
    GAACGATTAACAAAATTGCATAAAGCTTTACCAGACTTGGCAGTTACGAGTGATGTAATT
    GTTGGTTTCCCAGGTGAAACTGAAGCTGAGTTCCAAGAAACATATGATTTTATCGTAAAG
    CATAAGTTCTCTGAACTGCATGTTTTCCCTTATTCTCCTAGAATTGGCACGCCAGCTGCA
    AGAATGGATGACCAAATTGATGAAGAAATTAAAAATGAACGGGTGCATAAGTTAATTACG
    CTAAGCAATCAACTCGGAAAGTTATATGCGTCTAAATTTGATCAAGATGTGCTTGAAGTA
    ATTCCTGAGGAACAGGGTGACACAGAAGGTACATTAGTTGGATATGCAGATAATTATATG
    AAAGTACAATTTGAAGGTGACGAATCACTCATAGGTCAAATTGTAAAAGTTAAAATTACG
    CAAGCAAATTATCCATTAAATGAAGGGCAAGCAATTAAAGTTGTTGATTTCGCAACAAAT
    AAATCTGATAGAGAAGTTTTAGTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1347

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1479 [new locus tag: NWMN_RS08330 ]
  • symbol: NWMN_1479
  • description: hypothetical protein
  • length: 448
  • theoretical pI: 5.53724
  • theoretical MW: 50955.5
  • GRAVY: -0.397321

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    radical SAM methylthiotransferase, MiaB/RimO family (TIGR00089; EC 2.1.1.-,2.8.1.-; HMM-score: 494.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationMiaB-like tRNA modifying enzyme (TIGR01579; HMM-score: 476.1)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA-i(6)A37 thiotransferase enzyme MiaB (TIGR01574; EC 2.-.-.-; HMM-score: 354.1)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein S12 methylthiotransferase RimO (TIGR01125; EC 2.1.1.-,2.8.1.-; HMM-score: 295.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationMiaB-like tRNA modifying enzyme, archaeal-type (TIGR01578; HMM-score: 276.4)
    Unknown functionEnzymes of unknown specificityB12-binding domain/radical SAM domain protein, MJ_1487 family (TIGR04013; HMM-score: 95.7)
    Unknown functionEnzymes of unknown specificityB12-binding domain/radical SAM domain protein, MJ_0865 family (TIGR04014; HMM-score: 82.8)
    Cellular processesCellular processesToxin production and resistanceradical SAM P-methyltransferase, PhpK family (TIGR04479; EC 2.1.-.-; HMM-score: 52.1)
    hopanoid biosynthesis associated radical SAM protein HpnJ (TIGR03471; HMM-score: 39.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalamincoproporphyrinogen dehydrogenase HemZ (TIGR03994; EC 1.3.99.22; HMM-score: 33.3)
    Cellular processesCellular processesAdaptations to atypical conditionsKamA family protein (TIGR00238; HMM-score: 29.6)
    Unknown functionEnzymes of unknown specificityuncharacterized radical SAM protein YgiQ (TIGR03904; HMM-score: 29.3)
    Unknown functionEnzymes of unknown specificityradical SAM protein, TIGR01212 family (TIGR01212; HMM-score: 27.6)
    Unknown functionEnzymes of unknown specificityradical SAM family uncharacterized protein (TIGR03960; HMM-score: 25.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersLipoatelipoyl synthase (TIGR00510; EC 2.8.1.8; HMM-score: 24.1)
    magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase (TIGR02026; HMM-score: 20.8)
    Cellular processesCellular processesToxin production and resistancetryptophan 2-C-methyltransferase (TIGR04428; EC 2.1.1.106; HMM-score: 19.9)
    Cellular processesCellular processesAdaptations to atypical conditionsglutamate 2,3-aminomutase (TIGR04368; EC 5.4.3.9; HMM-score: 19.8)
    putative heme utilization radical SAM enzyme HutW (TIGR04107; HMM-score: 19)
    lysine-2,3-aminomutase-related protein (TIGR03822; EC 5.4.3.-; HMM-score: 15.7)
    His-Xaa-Ser system radical SAM maturase HxsC (TIGR03977; HMM-score: 15.3)
    Genetic information processingProtein fateProtein modification and repairEF-P beta-lysylation protein EpmB (TIGR03821; EC 5.4.3.-; HMM-score: 15.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminoxygen-independent coproporphyrinogen III oxidase (TIGR00538; EC 1.3.99.22; HMM-score: 13.4)
    lysine-2,3-aminomutase (TIGR03820; EC 5.4.3.2; HMM-score: 13.4)
    B12-binding domain/radical SAM domain protein, rhizo-twelve system (TIGR04295; HMM-score: 11.3)
  • TheSEED:  
    Protein MetabolismProtein processing and modificationRibosomal protein S12p Asp methylthiotransferase tRNA-t(6)A37 methylthiotransferase 
    RNA MetabolismRNA processing and modificationMethylthiotransferases tRNA-t(6)A37 methylthiotransferase 
    Stress ResponseHeat shockHeat shock dnaK gene cluster extended tRNA-t(6)A37 methylthiotransferase 
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 102.8)
    CheY (CL0304) UPF0004; Uncharacterized protein family UPF0004 (PF00919; HMM-score: 92.2)
    OB (CL0021) TRAM; TRAM domain (PF01938; HMM-score: 27.7)
    NADP_Rossmann (CL0063) B12-binding; B12 binding domain (PF02310; HMM-score: 18.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.134
    • Ymax_pos: 21
    • Cmax: 0.13
    • Cmax_pos: 21
    • Smax: 0.218
    • Smax_pos: 1
    • Smean: 0.138
    • D: 0.136
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSTVAFHTLGCKVNHYETEAIWQLFKEANYERVDFEANADVFVINTCTVTNTGDKKSRQIIRRAIRQNPDAVICVTGCYAQTSSAEIMEIPGVDVVVGTQDRHKLLGYIDEFRKERQPINGVGNIMKNRKYEELDVPYFTDRTRASLKIQEGCNNFCTFCIIPWARGLMRSRDPEKVVEQATQLVNSGYKEIVLTGIHTGGYGQDLKDYNLAQLLRDLETINGLERIRISSIEASQLTDEVIDVLERSTKVVRHLHIPLQSGSDTVLKRMRRKYTMDRFSERLTKLHKALPDLAVTSDVIVGFPGETEAEFQETYDFIVKHKFSELHVFPYSPRIGTPAARMDDQIDEEIKNERVHKLITLSNQLGKLYASKFDQDVLEVIPEEQGDTEGTLVGYADNYMKVQFEGDESLIGQIVKVKITQANYPLNEGQAIKVVDFATNKSDREVLV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]