From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1959 [new locus tag: NWMN_RS11300 ]
  • pan locus tag?: SAUPAN005301000
  • symbol: NWMN_1959
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1959 [new locus tag: NWMN_RS11300 ]
  • symbol: NWMN_1959
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2168480..2168974
  • length: 495
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGAATGAAAAGCATAATATAGGAGAATCAACATTGATAAAGATAAATAATTTAGATGAA
    ATGAATCAATTTGCTATATTTTTAGTTGAGCAATTGAAAAGTGGTGATTTGATTTTACTT
    AACGGAGATTTAGGAGCAGGTAAAACAACGTTAACGCAATTTATAGGAAAAGCTCTTGGT
    GTAAGACGTACGATTAATTCCCCGACATTTAACATCATTAAATCATATAGGGGTAAAAAT
    TTAAAATTGCATCATATGGATTGTTATCGCTTAGAAGATTCTGATGAAGATTTAGGATTT
    GATGAATTTTTCGAAGATCAGGCAATTACTGTTATTGAATGGAGTCAATTTATAAAAGAT
    TTACTTCCAGCGACGCATTTATCTATTAACATTTCAACAATATCTGAAAATACAAGACAA
    ATTGAGTTGTTCGCGCAAGGAGAACATTATGAACAAATTAAGGAGGCAATTATCCATGAA
    TTCGCTGCTCATTGA
    60
    120
    180
    240
    300
    360
    420
    480
    495

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1959 [new locus tag: NWMN_RS11300 ]
  • symbol: NWMN_1959
  • description: hypothetical protein
  • length: 164
  • theoretical pI: 4.87524
  • theoretical MW: 18736.1
  • GRAVY: -0.27561

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 128.2)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 15.4)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 14.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 12.6)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.5)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 12)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 11.7)
  • TheSEED:  
    Cell Wall and CapsuleCell Wall and Capsule - no subcategoryYjeE TsaE protein, required for threonylcarbamoyladenosine t(6)A37 formation in tRNA 
    Regulation and Cell signalingRegulation and Cell signaling - no subcategoryCell envelope-associated LytR-CpsA-Psr transcriptional attenuators TsaE protein, required for threonylcarbamoyladenosine t(6)A37 formation in tRNA 
    RNA MetabolismRNA processing and modificationYrdC-YciO-Sua5 and associated protein families TsaE protein, required for threonylcarbamoyladenosine t(6)A37 formation in tRNA 
  • PFAM:
    P-loop_NTPase (CL0023) TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 122.8)
    AAA_18; AAA domain (PF13238; HMM-score: 21.5)
    NACHT; NACHT domain (PF05729; HMM-score: 16)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 14.8)
    dNK; Deoxynucleoside kinase (PF01712; HMM-score: 14.5)
    AAA_23; AAA domain (PF13476; HMM-score: 14.3)
    ABC_tran; ABC transporter (PF00005; HMM-score: 13.2)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 12.9)
    AAA_33; AAA domain (PF13671; HMM-score: 12.3)
    TIM_barrel (CL0036) DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 12)
    P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.9)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.106
    • Ymax_pos: 11
    • Cmax: 0.109
    • Cmax_pos: 46
    • Smax: 0.174
    • Smax_pos: 2
    • Smean: 0.098
    • D: 0.103
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNEKHNIGESTLIKINNLDEMNQFAIFLVEQLKSGDLILLNGDLGAGKTTLTQFIGKALGVRRTINSPTFNIIKSYRGKNLKLHHMDCYRLEDSDEDLGFDEFFEDQAITVIEWSQFIKDLLPATHLSINISTISENTRQIELFAQGEHYEQIKEAIIHEFAAH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]