From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2023 [new locus tag: NWMN_RS11690 ]
  • pan locus tag?: SAUPAN005410000
  • symbol: tdk
  • pan gene symbol?: tdk
  • synonym:
  • product: thymidine kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2023 [new locus tag: NWMN_RS11690 ]
  • symbol: tdk
  • product: thymidine kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 2239315..2239914
  • length: 600
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGTATGAAACTTACCATTCCGGTTGGATAGAATGTATTACAGGTAGTATGTTTAGCGGT
    AAATCCGAAGAACTAATAAGACGTCTAAGAAGGGGTATATACGCTAAACAAAAAGTCGTT
    GTATTTAAACCGGCGATTGATGATCGATATCATAAAGAAAAAGTGGTCTCTCATAATGGT
    AATGCCATTGAAGCGATTAATATTTCTAAAGCAAGTGAAATTATGACGCACGACTTAACT
    AATGTTGATGTTATAGGAATAGACGAAGTGCAATTTTTTGACGATGAAATTGTAAGTATA
    GTAGAAAAACTATCAGCAGATGGACACCGTGTTATTGTTGCTGGATTAGATATGGATTTT
    AGGGGCGAACCGTTCGAACCAATGCCTAAATTGATGGCTGTCAGTGAACAAGTAACGAAA
    CTTCAAGCAGTTTGTGCTGTTTGTGGTTCTTCATCTAGTAGAACGCAACGATTAATAAAT
    GGTAAACCAGCTAAAATCGATGATCCGATTATCTTAGTAGGTGCCAATGAAAGTTATGAG
    CCACGTTGTCGCGCGCACCATATCGTAGCACCTAGTGATAATAATAAGGAGGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2023 [new locus tag: NWMN_RS11690 ]
  • symbol: Tdk
  • description: thymidine kinase
  • length: 199
  • theoretical pI: 5.89459
  • theoretical MW: 22214.2
  • GRAVY: -0.264322

Function[edit source | edit]

  • reaction:
    EC 2.7.1.21?  ExPASy
    Thymidine kinaseATP + thymidine = ADP + thymidine 5'-phosphate
  • TIGRFAM:
    Cellular processesCellular processesChemotaxis and motilityflagellar motor switch protein FliG (TIGR00207; HMM-score: 14.4)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsFolate and pterinesFolate Biosynthesis Thymidine kinase (EC 2.7.1.21) 
    Nucleosides and NucleotidesPyrimidinespyrimidine conversions Thymidine kinase (EC 2.7.1.21) 
  • PFAM:
    P-loop_NTPase (CL0023) TK; Thymidine kinase (PF00265; HMM-score: 196.6)
    AAA_19; AAA domain (PF13245; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.105
    • Ymax_pos: 48
    • Cmax: 0.11
    • Cmax_pos: 23
    • Smax: 0.151
    • Smax_pos: 44
    • Smean: 0.087
    • D: 0.098
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MYETYHSGWIECITGSMFSGKSEELIRRLRRGIYAKQKVVVFKPAIDDRYHKEKVVSHNGNAIEAINISKASEIMTHDLTNVDVIGIDEVQFFDDEIVSIVEKLSADGHRVIVAGLDMDFRGEPFEPMPKLMAVSEQVTKLQAVCAVCGSSSSRTQRLINGKPAKIDDPIILVGANESYEPRCRAHHIVAPSDNNKEEL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]