From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2483 [new locus tag: NWMN_RS14255 ]
  • pan locus tag?: SAUPAN006262000
  • symbol: NWMN_2483
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2483 [new locus tag: NWMN_RS14255 ]
  • symbol: NWMN_2483
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2730154..2731260
  • length: 1107
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGCAACATCATAAAGTGGCTATTATCGGTGCCGGTGCTGCAGGTATAGGTATGGCCATT
    ACCTTAAAAGATTTCGGTATAACAGATGTCATTATTTTAGAAAAAGGAACAGTAGGACAT
    TCATTTAAACATTGGCCGAAATCGACCCGTACGATCACGCCATCATTTACGTCTAATGGA
    TTTGGCATGCCTGATATGAATGCAATTTCCATGGATACTTCACCAGCATTTACATTTAAT
    GAAGAACATATTTCCGGAGAAACATATGCTGAATATTTACAAGTGGTTGCCAACCATTAC
    GAGCTGAATATCTTTGAAAATACAGTTGTCACAAATATATCTGTAGATGATGCATATTAT
    ACGATTGCAACGACAACAGAGATATATCACGCGGATTATATCTTTGTCGCAACAGGTGAT
    TATAATTTCCCTAAAAAGCCATTTAAATATGGTATTCATTATAGTGAAATTGAAGACTTT
    GATAACTTTAATAAGGGGCAATATGTGGTTATCGGAGGTAATGAAAGTGGCTTTGATGCT
    GCATATCAACTTGCAAAAAATGGCTCTGACATCGCACTTTATACTAGCACAACCGGTTTA
    AATGATCCGGATGCTGATCCTAGTGTTAGATTGTCACCTTATACACGTCAGCGACTAGGT
    AATGTCATTAAGCAAGGTGCTCGCATCGAAATGAATGTACATTATACAGTTAAAGATATT
    GATTTTAACAATGGACAGTATCATATCAGTTTTGATAGCGGACAAAGTGTGCTTACACCT
    CATGAACCAATACTAGCAACTGGCTTTGATGCAACAAAAAATCCAATCGTTCAACAATTA
    TTTGTGACAACAAATCAAGATATTAAATTAACAACACATGATGAATCGACACGTTATCCG
    AATATTTTTATGATTGGTGCAACAGTTGAAAATGATAATGCCAAATTATGCTATATCTAT
    AAATTTAGAGCGCGATTTGCAGTACTTGCACATCTTTTAACACAGCGGGAAGGCTTACCA
    GCTAAACAAGATGTCATTGAAAATTATCAAAAAAATCAAATGTATTTAGATGATTATTCA
    TGTTGTGAAGTGTCATGCACATGTTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1107

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2483 [new locus tag: NWMN_RS14255 ]
  • symbol: NWMN_2483
  • description: hypothetical protein
  • length: 368
  • theoretical pI: 5.0566
  • theoretical MW: 41168.8
  • GRAVY: -0.294565

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 94.3)
    flavin-dependent oxidoreductase, MSMEG_0569 family (TIGR04046; HMM-score: 51.8)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 36.6)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 32.3)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 25.8)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 23.7)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 23.7)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 20.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 19.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 19.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesL-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 19.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 18.9)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 18.6)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 17.9)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, beta subunit family (TIGR01373; HMM-score: 17.8)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, monomeric form (TIGR01377; HMM-score: 17.7)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 16.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 15)
    MetabolismAmino acid biosynthesisPyruvate familyketol-acid reductoisomerase (TIGR00465; EC 1.1.1.86; HMM-score: 14.6)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 14.2)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 14.1)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 13.4)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 13.4)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 13.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 12.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 12.4)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 12.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 12.2)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 11.9)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 11.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprotoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 11.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme A2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 11.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 11.1)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 11.1)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 9.5)
  • TheSEED:  
    FIG016210: probable monooxygenase 
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 324.8)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 58.9)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 30.2)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 29.6)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 29.4)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 27.5)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 24.5)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 21.2)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 20.4)
    Thi4; Thi4 family (PF01946; HMM-score: 19.7)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 19.4)
    IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 17.4)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 14.5)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 13.9)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.83
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.155
    • Ymax_pos: 11
    • Cmax: 0.136
    • Cmax_pos: 41
    • Smax: 0.318
    • Smax_pos: 5
    • Smean: 0.233
    • D: 0.186
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MQHHKVAIIGAGAAGIGMAITLKDFGITDVIILEKGTVGHSFKHWPKSTRTITPSFTSNGFGMPDMNAISMDTSPAFTFNEEHISGETYAEYLQVVANHYELNIFENTVVTNISVDDAYYTIATTTEIYHADYIFVATGDYNFPKKPFKYGIHYSEIEDFDNFNKGQYVVIGGNESGFDAAYQLAKNGSDIALYTSTTGLNDPDADPSVRLSPYTRQRLGNVIKQGARIEMNVHYTVKDIDFNNGQYHISFDSGQSVLTPHEPILATGFDATKNPIVQQLFVTTNQDIKLTTHDESTRYPNIFMIGATVENDNAKLCYIYKFRARFAVLAHLLTQREGLPAKQDVIENYQKNQMYLDDYSCCEVSCTC

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: NWMN_1457 (Zur*)
    Zur* (TF) important in Zinc homeostasis  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]