From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS05195 [old locus tag: NWMN_0928 ]
  • pan locus tag?: SAUPAN003268000
  • symbol: NWMN_RS05195
  • pan gene symbol?: qoxC
  • synonym:
  • product: quinol oxidase subunit 3

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS05195 [old locus tag: NWMN_0928 ]
  • symbol: NWMN_RS05195
  • product: quinol oxidase subunit 3
  • replicon: chromosome
  • strand: -
  • coordinates: 1029656..1030261
  • length: 606
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1029656..1030261) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAGTCATGATACAAACACTATTGATTCACGCACACATGAAGGCGAATTAAATAAGCTT
    GGCTTTTGGATTTTCATTACAGCCGAATTTGCGTTATTCGGTACCCTATTTGCGACACTA
    TTAACTTTGCAACATGGTGGCGATTATGCAGGTAAAATGACTACTGAGTTATTTGAATTG
    CCTCTTGTTTTAATAATGACGTTTGCATTATTATTCAGTTCTTACACATGTGGTATTGCT
    ATTTACTACATGCGCCAAGAAAAACAAAAGTTAATGATGTTTTGGATGATCATTACGTTA
    CTTTTAGGTTTAGTCTTTGTTGGATTCGAAATTTATGAATTCGCACACTATGCATCAGAA
    GGCGTTAACCCAACAATTGGTTCTTACTGGTCTAGTTTCTTTATCCTATTAGGAACGCAT
    GGTTGTCACGTATCGCTAGGTATCGTTTGGGCCATTTGTTTATTAATCCAAATCCAACGA
    CGCGGATTAGACAAATATAATGCGCCAAAATTATTTATAGTAAGTTTATACTGGCACTTC
    TTAGATGTTGTTTGGGTTTTCATCTTTACTGCCGTATATATGATAGGGATGGTGTATAGC
    GGATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    606

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS05195 [old locus tag: NWMN_0928 ]
  • symbol: NWMN_RS05195
  • description: quinol oxidase subunit 3
  • length: 201
  • theoretical pI: 6.38351
  • theoretical MW: 23057
  • GRAVY: 0.666169

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismEnergy metabolismElectron transportcytochrome aa3 quinol oxidase, subunit III (TIGR02897; EC 1.10.3.-; HMM-score: 359)
    MetabolismEnergy metabolismElectron transportcytochrome o ubiquinol oxidase, subunit III (TIGR02842; EC 1.10.3.-; HMM-score: 188.3)
  • TheSEED:
  • PFAM:
    no clan definedCOX3; Cytochrome c oxidase subunit III (PF00510; HMM-score: 51.6)
    STE2; Fungal pheromone mating factor STE2 GPCR (PF02116; HMM-score: 17.8)
    PsbL; PsbL protein (PF02419; HMM-score: 13.7)
    Yip1 (CL0112) DUF1129; Protein of unknown function (DUF1129) (PF06570; HMM-score: 6.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 5
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 51
    • Cmax: 0.15
    • Cmax_pos: 51
    • Smax: 0.137
    • Smax_pos: 45
    • Smean: 0.071
    • D: 0.097
  • predicted transmembrane helices (TMHMM): 5

Accession numbers[edit source | edit]

  • GI: 445939881 NCBI
  • RefSeq: WP_000017736 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSHDTNTIDSRTHEGELNKLGFWIFITAEFALFGTLFATLLTLQHGGDYAGKMTTELFELPLVLIMTFALLFSSYTCGIAIYYMRQEKQKLMMFWMIITLLLGLVFVGFEIYEFAHYASEGVNPTIGSYWSSFFILLGTHGCHVSLGIVWAICLLIQIQRRGLDKYNAPKLFIVSLYWHFLDVVWVFIFTAVYMIGMVYSG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS05195 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]