From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06420 [old locus tag: NWMN_1138 ]
  • pan locus tag?: SAUPAN003512000
  • symbol: NWMN_RS06420
  • pan gene symbol?: fapR
  • synonym:
  • product: transcription factor

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS06420 [old locus tag: NWMN_1138 ]
  • symbol: NWMN_RS06420
  • product: transcription factor
  • replicon: chromosome
  • strand: +
  • coordinates: 1248050..1248622
  • length: 573
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1248050..1248622) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAGGGGTGAGACGTTGAAACTAAAGAAAGATAAACGTAGAGAAGCAATCAGACAACAA
    ATTGATAGCAATCCCTTCATCACAGACCATGAACTAAGCGACTTATTTCAAGTGAGTATA
    CAAACAATTCGTTTAGATCGCACTTATTTAAACATACCAGAATTAAGGAAGCGTATTAAA
    TTAGTTGCTGAAAAGAATTATGACCAAATAAGTTCTATTGAAGAACAAGAATTTATTGGT
    GATTTGATTCAAGTCAATCCAAATGTTAAAGCGCAATCAATTTTAGATATTACATCGGAT
    TCTGTTTTTCATAAAACTGGAATTGCGCGTGGTCATGTGCTGTTTGCTCAGGCAAATTCG
    TTATGTGTTGCGCTAATTAAGCAACCAACAGTTTTAACTCATGAGAGTAGCATTCAATTT
    ATTGAAAAAGTAAAATTAAATGATACGGTAAGAGCAGAAGCACGAGTTGTAAATCAAACT
    GCAAAACATTATTACGTCGAAGTAAAGTCATATGTTAAACATACATTAGTTTTCAAAGGA
    AATTTTAAAATGTTTTATGATAAGCGAGGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    573

Protein[edit source | edit]

Protein Data Bank: 4A0X
Protein Data Bank: 4A0Y
Protein Data Bank: 4A0Z
Protein Data Bank: 4A12

General[edit source | edit]

  • locus tag: NWMN_RS06420 [old locus tag: NWMN_1138 ]
  • symbol: NWMN_RS06420
  • description: transcription factor
  • length: 190
  • theoretical pI: 9.98992
  • theoretical MW: 21990.1
  • GRAVY: -0.406842

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    phenylacetic acid degradation protein PaaD (TIGR02286; HMM-score: 19.3)
    uncharacterized domain 1 (TIGR00369; HMM-score: 12.6)
  • TheSEED:
  • PFAM:
    HotDog (CL0050) 4HBT; Thioesterase superfamily (PF03061; HMM-score: 24.4)
    MaoC_dehydratas; MaoC like domain (PF01575; HMM-score: 21.1)
    HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 18.4)
    HTH_11; HTH domain (PF08279; HMM-score: 14.2)
    no clan definedSigma54_AID; Sigma-54 factor, Activator interacting domain (AID) (PF00309; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.137
    • Ymax_pos: 11
    • Cmax: 0.102
    • Cmax_pos: 41
    • Smax: 0.265
    • Smax_pos: 2
    • Smean: 0.171
    • D: 0.15
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI:
  • RefSeq: WP_001548538 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MRGETLKLKKDKRREAIRQQIDSNPFITDHELSDLFQVSIQTIRLDRTYLNIPELRKRIKLVAEKNYDQISSIEEQEFIGDLIQVNPNVKAQSILDITSDSVFHKTGIARGHVLFAQANSLCVALIKQPTVLTHESSIQFIEKVKLNDTVRAEARVVNQTAKHYYVEVKSYVKHTLVFKGNFKMFYDKRG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS06420 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]