From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1071 [new locus tag: SA_RS06070 ]
  • pan locus tag?: SAUPAN003512000
  • symbol: SA1071
  • pan gene symbol?: fapR
  • synonym:
  • product: fatty acid biosynthesis transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1071 [new locus tag: SA_RS06070 ]
  • symbol: SA1071
  • product: fatty acid biosynthesis transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 1212289..1212846
  • length: 558
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    TTGAAACTAAAGAAAGATAAACGTAGAGAAGCAATCAGACAACAAATTGATAGCAATCCC
    TTCATCACAGACCATGAACTAAGCGACTTATTTCAAGTGAGTATACAAACAATTCGTTTA
    GATCGCACTTATTTAAACATACCAGAATTAAGGAAGCGTATTAAATTAGTTGCTGAAAAG
    AATTATGACCAAATAAGTTCTATTGAAGAACAAGAATTTATTGGTGATTTGATTCAAGTC
    AATCCAAATGTTAAAGCGCAATCAATTTTAGATATTACATCGGATTCTGTTTTTCATAAA
    ACTGGAATTGCGCGTGGTCATGTGCTGTTTGCTCAGGCAAATTCGTTATGTGTTGCGCTA
    ATTAAGCAACCAACAGTTTTAACTCATGAGAGTAGCATTCAATTTATTGAAAAAGTAAAA
    TTAAATGATACGGTAAGAGCAGAAGCACGAGTTGTAAATCAAACTGCAAAACATTATTAC
    GTCGAAGTAAAGTCATATGTTAAACATACATTAGTTTTCAAAGGAAATTTTAAAATGTTT
    TATGATAAGCGAGGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    558

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1071 [new locus tag: SA_RS06070 ]
  • symbol: SA1071
  • description: fatty acid biosynthesis transcriptional regulator
  • length: 185
  • theoretical pI: 9.99026
  • theoretical MW: 21433.5
  • GRAVY: -0.389189

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    phenylacetic acid degradation protein PaaD (TIGR02286; HMM-score: 19.4)
    uncharacterized domain 1 (TIGR00369; HMM-score: 12.6)
  • TheSEED:  
    Transcription factor FapR 
  • PFAM:
    HotDog (CL0050) 4HBT; Thioesterase superfamily (PF03061; HMM-score: 24.4)
    MaoC_dehydratas; MaoC like domain (PF01575; HMM-score: 21.1)
    HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 18.5)
    HTH_11; HTH domain (PF08279; HMM-score: 14.2)
    no clan definedSigma54_AID; Sigma-54 factor, Activator interacting domain (AID) (PF00309; HMM-score: 12)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.121
    • Ymax_pos: 11
    • Cmax: 0.103
    • Cmax_pos: 36
    • Smax: 0.204
    • Smax_pos: 1
    • Smean: 0.132
    • D: 0.125
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKLKKDKRREAIRQQIDSNPFITDHELSDLFQVSIQTIRLDRTYLNIPELRKRIKLVAEKNYDQISSIEEQEFIGDLIQVNPNVKAQSILDITSDSVFHKTGIARGHVLFAQANSLCVALIKQPTVLTHESSIQFIEKVKLNDTVRAEARVVNQTAKHYYVEVKSYVKHTLVFKGNFKMFYDKRG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA1071 (FapR*)
    FapR* (TF) important in Fatty acid biosynthesisRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]