Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0843 [new locus tag: SA_RS04785 ]
  • pan locus tag?: SAUPAN003128000
  • symbol: fab
  • pan gene symbol?: fabF
  • synonym:
  • product: 3-oxoacyl-ACP synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0843 [new locus tag: SA_RS04785 ]
  • symbol: fab
  • product: 3-oxoacyl-ACP synthase
  • replicon: chromosome
  • strand: +
  • coordinates: 956103..957347
  • length: 1245
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGAGTCAAAATAAAAGAGTAGTTATTACAGGTATGGGAGCCCTTTCTCCAATCGGTAAT
    GATGTCAAAACAACATGGGAGAATGCTCTAAAAGGCGTAAATGGTATCGATAAAATTACA
    CGTATCGATACTGAACCTTATAGCGTTCACTTAGCAGGAGAACTTAAAAACTTTAATATT
    GAAGATCATATCGACAAAAAAGAAGCGCGTCGTATGGATAGATTTACTCAATATGCAATT
    GTAGCAGCTAGAGAGGCTGTTAAAGATGCGCAATTAGATATCAATGATAATACTGCAGAT
    CGAATCGGTGTATGGATTGGTTCTGGTATCGGTGGTATGGAAACATTTGAAATTGCACAT
    AAACAATTAATGGATAAAGGCCCAAGACGTGTGAGTCCATTTTTCGTACCAATGTTAATT
    CCTGATATGGCAACTGGGCAAGTATCAATTGACTTAGGTGCAAAAGGACCAAATGGTGCA
    ACAGTTACAGCATGTGCAACAGGTACAAACTCAATCGGAGAAGCATTTAAAATTGTGCAA
    CGCGGTGATGCAGATGCAATGATTACTGGTGGTACGGAAGCTCCAATCACTCATATGGCA
    ATTGCAGGTTTCAGTGCAAGTCGAGCGCTTTCTACAAATGATGACATTGAAACAGCATGT
    CGTCCATTCCAAGAAGGTAGAGACGGTTTTGTTATGGGTGAAGGTGCTGGTATTTTAGTA
    ATCGAATCTTTAGAATCAGCACAAGCTCGAGGTGCCAATATTTATGCTGAGATAGTTGGC
    TATGGTACTACAGGTGATGCTTATCATATTACAGCGCCAGCTCCAGAAGGTGAAGGCGGT
    TCTAGAGCAATGCAAGCAGCTATGGATGATGCTGGTATTGAACCTAAAGATGTACAATAC
    TTAAATGCCCATGGTACAAGTACTCCTGTTGGTGACTTAAATGAAGTTAAAGCTATTAAA
    AATACATTTGGTGAAGCAGCTAAACACTTAAAAGTTAGCTCAACAAAATCAATGACTGGT
    CACTTACTTGGTGCAACAGGTGGAATTGAAGCAATCTTCTCAGCGCTTTCAATTAAAGAC
    TCTAAAGTCGCACCGACAATACATGCGGTAACACCAGACCCAGAATGTGATTTGGATATT
    GTTCCAAATGAAGCGCAAGACCTTGATATTACTTATGCAATGAGTAATAGCTTAGGATTC
    GGTGGACATAACGCAGTATTAGTATTCAAGAAATTTGAAGCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1245

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0843 [new locus tag: SA_RS04785 ]
  • symbol: Fab
  • description: 3-oxoacyl-ACP synthase
  • length: 414
  • theoretical pI: 4.81762
  • theoretical MW: 43725
  • GRAVY: -0.167633

Function[edit source | edit]

  • reaction:
    EC 2.3.1.179?  ExPASy
    Beta-ketoacyl-[acyl-carrier-protein] synthase II(Z)-hexadec-11-enoyl-[acyl-carrier-protein] + malonyl-[acyl-carrier-protein] = (Z)-3-oxooctadec-13-enoyl-[acyl-carrier-protein] + CO2 + [acyl-carrier-protein]
  • TIGRFAM:
    MetabolismFatty acid and phospholipid metabolismBiosynthesisbeta-ketoacyl-acyl-carrier-protein synthase II (TIGR03150; EC 2.3.1.179; HMM-score: 639.2)
    polyketide-type polyunsaturated fatty acid synthase PfaA (TIGR02813; HMM-score: 106.5)
    MetabolismFatty acid and phospholipid metabolismOtheracetyl-CoA C-acyltransferase (TIGR01930; EC 2.3.1.16; HMM-score: 23.7)
    3-oxoadipyl-CoA thiolase (TIGR02430; EC 2.3.1.174; HMM-score: 12.7)
  • TheSEED:  
    Fatty Acids, Lipids, and IsoprenoidsFatty acidsFatty Acid Biosynthesis FASII 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.179) 
    COG1399 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.179) 
  • PFAM:
    Thiolase (CL0046) ketoacyl-synt; Beta-ketoacyl synthase, N-terminal domain (PF00109; HMM-score: 208)
    Ketoacyl-synt_C; Beta-ketoacyl synthase, C-terminal domain (PF02801; HMM-score: 130.9)
    Thiolase_N; Thiolase, N-terminal domain (PF00108; HMM-score: 16.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [1] (data from MRSA252)
    SA0365(ahpF)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1184(citB)aconitate hydratase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0723(clpP)ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    SA1940(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA1074(fabG)3-oxoacyl-ACP reductase  [1] (data from MRSA252)
    SA1901(fabZ)(3R)-hydroxymyristoyl-ACP dehydratase  [1] (data from MRSA252)
    SA1927(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [1] (data from MRSA252)
    SA0376(guaA)GMP synthase  [1] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [1] (data from MRSA252)
    SA0819(gudB)NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1521(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [1] (data from MRSA252)
    SA0500(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SA1499(tig)trigger factor  [1] (data from MRSA252)
    SA1177(tkt)transketolase  [1] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SA1535(tpx)thiol peroxidase  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA0224hypothetical protein  [1] (data from MRSA252)
    SA0295hypothetical protein  [1] (data from MRSA252)
    SA0468hypothetical protein  [1] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SA0618hypothetical protein  [1] (data from MRSA252)
    SA0627hypothetical protein  [1] (data from MRSA252)
    SA0641hypothetical protein  [1] (data from MRSA252)
    SA0707hypothetical protein  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA0859hypothetical protein  [1] (data from MRSA252)
    SA0873hypothetical protein  [1] (data from MRSA252)
    SA1599translaldolase  [1] (data from MRSA252)
    SA1735manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.21
    • Ymax_pos: 25
    • Cmax: 0.152
    • Cmax_pos: 25
    • Smax: 0.477
    • Smax_pos: 1
    • Smean: 0.296
    • D: 0.243
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSQNKRVVITGMGALSPIGNDVKTTWENALKGVNGIDKITRIDTEPYSVHLAGELKNFNIEDHIDKKEARRMDRFTQYAIVAAREAVKDAQLDINDNTADRIGVWIGSGIGGMETFEIAHKQLMDKGPRRVSPFFVPMLIPDMATGQVSIDLGAKGPNGATVTACATGTNSIGEAFKIVQRGDADAMITGGTEAPITHMAIAGFSASRALSTNDDIETACRPFQEGRDGFVMGEGAGILVIESLESAQARGANIYAEIVGYGTTGDAYHITAPAPEGEGGSRAMQAAMDDAGIEPKDVQYLNAHGTSTPVGDLNEVKAIKNTFGEAAKHLKVSSTKSMTGHLLGATGGIEAIFSALSIKDSKVAPTIHAVTPDPECDLDIVPNEAQDLDITYAMSNSLGFGGHNAVLVFKKFEA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA1071 (FapR*)
    FapR* (TF) important in Fatty acid biosynthesis  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 1.76 1.77 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J. Microbiol. Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)