From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2024 [new locus tag: SA_RS11640 ]
  • pan locus tag?: SAUPAN005677000
  • symbol: rpsK
  • pan gene symbol?: rpsK
  • synonym:
  • product: 30S ribosomal protein S11

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2024 [new locus tag: SA_RS11640 ]
  • symbol: rpsK
  • product: 30S ribosomal protein S11
  • replicon: chromosome
  • strand: -
  • coordinates: 2296130..2296519
  • length: 390
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGCACGTAAACAAGTATCTCGTAAACGTAGAGTGAAAAAGAATATTGAAAATGGTGTA
    GCACACATCCGTTCAACATTCAACAACACTATTGTAACTATCACTGATGAGTTCGGTAAT
    GCTTTATCATGGTCATCAGCTGGTGCATTAGGATTCAAAGGATCTAAAAAATCAACACCA
    TTTGCAGCACAAATGGCTTCTGAAACTGCATCTAAATCAGCTATGGAGCATGGTTTAAAA
    ACAGTTGAAGTAACAGTTAAAGGACCTGGTCCAGGTCGTGAATCAGCTATTCGTGCATTA
    CAATCTGCAGGTTTAGAAGTAACTGCGATCAGAGACGTTACTCCAGTACCTCATAACGGT
    TGTCGTCCACCAAAACGTCGTCGTGTATAA
    60
    120
    180
    240
    300
    360
    390

Protein[edit source | edit]

Protein Data Bank: 5LI0

General[edit source | edit]

  • locus tag: SA2024 [new locus tag: SA_RS11640 ]
  • symbol: RpsK
  • description: 30S ribosomal protein S11
  • length: 129
  • theoretical pI: 11.8008
  • theoretical MW: 13881.8
  • GRAVY: -0.510078

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uS11 (TIGR03632; HMM-score: 197.1)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uS11 (TIGR03628; HMM-score: 90.5)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisRibosome SSU bacterial SSU ribosomal protein S11p (S14e) 
  • PFAM:
    S11_L18p (CL0267) Ribosomal_S11; Ribosomal protein S11 (PF00411; HMM-score: 171.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA1517(citC)isocitrate dehydrogenase  [2] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [2] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA1074(fabG)3-oxoacyl-ACP reductase  [2] (data from MRSA252)
    SA1028(ftsA)cell division protein  [2] (data from MRSA252)
    SA1836(groEL)molecular chaperone GroEL  [2] (data from MRSA252)
    SA1504(infC)translation initiation factor IF-3  [2] (data from MRSA252)
    SA0038(mecA)penicillin binding protein 2 prime  [2] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [2] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [2] (data from MRSA252)
    SA0454(purR)pur operon repressor  [2] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [2] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA2040(rplP)50S ribosomal protein L16  [2] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [2] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [2] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [2] (data from MRSA252)
    SA0295hypothetical protein  [2] (data from MRSA252)
    SA0466hypothetical protein  [2] (data from MRSA252)
    SA0626hypothetical protein  [2] (data from MRSA252)
    SA0627hypothetical protein  [2] (data from MRSA252)
    SA0637hypothetical protein  [2] (data from MRSA252)
    SA0663hypothetical protein  [2] (data from MRSA252)
    SA0940hypothetical protein  [2] (data from MRSA252)
    SA1118hypothetical protein  [2] (data from MRSA252)
    SA1528hypothetical protein  [2] (data from MRSA252)
    SA1549hypothetical protein  [2] (data from MRSA252)
    SA1559hypothetical protein  [2] (data from MRSA252)
    SA1565hypothetical protein  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.247
    • Ymax_pos: 11
    • Cmax: 0.152
    • Cmax_pos: 66
    • Smax: 0.747
    • Smax_pos: 3
    • Smean: 0.622
    • D: 0.394
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MARKQVSRKRRVKKNIENGVAHIRSTFNNTIVTITDEFGNALSWSSAGALGFKGSKKSTPFAAQMASETASKSAMEHGLKTVEVTVKGPGPGRESAIRALQSAGLEVTAIRDVTPVPHNGCRPPKRRRV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37

Relevant publications[edit source | edit]