From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1520 [new locus tag: SA_RS08560 ]
  • pan locus tag?: SAUPAN004324000
  • symbol: pykA
  • pan gene symbol?: pykA
  • synonym:
  • product: pyruvate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1520 [new locus tag: SA_RS08560 ]
  • symbol: pykA
  • product: pyruvate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 1734257..1736014
  • length: 1758
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    ATGAGAAAAACTAAAATTGTATGTACAATTGGACCAGCTTCAGAATCAGAAGAAATGATT
    GAGAAATTAATCAATGCTGGTATGAACGTTGCACGATTAAACTTTTCACATGGTAGTCAT
    GAAGAGCATAAAGGTAGAATTGATACAATTCGTAAAGTAGCTAAAAGATTAGACAAAATT
    GTAGCAATTTTATTAGATACGAAAGGTCCAGAAATTCGTACGCATAATATGAAAGACGGT
    ATCATTGAACTTGAACGTGGTAACGAAGTTATTGTTAGCATGAATGAAGTTGAAGGAACA
    CCTGAAAAGTTCTCAGTAACATATGAAAACTTAATTAACGATGTTCAAGTAGGTTCATAC
    ATTTTACTTGATGATGGCTTAATTGAATTACAAGTTAAAGATATTGACCATGCTAAAAAA
    GAAGTTAAATGTGATATTTTAAACTCTGGTGAGCTTAAAAACAAAAAAGGTGTTAACTTA
    CCTGGTGTAAGAGTAAGTTTACCTGGTATTACAGAAAAAGATGCTGAAGATATCCGTTTC
    GGTATTAAAGAAAATGTTGACTTCATTGCAGCAAGTTTCGTACGTCGTCCTAGTGATGTT
    TTAGAAATTCGTGAAATTTTAGAAGAACAAAAAGCTAACATTTCAGTATTCCCTAAAATT
    GAAAACCAAGAAGGTATTGATAATATTGCGGAAATTCTTGAAGTGTCTGATGGTTTAATG
    GTTGCACGTGGTGACATGGGTGTTGAAATTCCACCTGAAAAAGTACCAATGGTTCAAAAA
    GATTTAATCAGACAATGTAACAAATTAGGTAAACCAGTTATTACAGCTACACAAATGTTA
    GATTCTATGCAACGTAACCCACGTGCTACACGTGCAGAAGCTAGTGACGTTGCCAACGCA
    ATCTATGATGGTACAGATGCAGTAATGTTATCTGGTGAAACTGCTGCTGGTTTATATCCT
    GAAGAAGCTGTTAAAACAATGAGAAATATTGCTGTATCAGCTGAAGCAGCCCAAGATTAT
    AAAAAGTTATTGTCAGATCGTACTAAATTAGTTGAAACTTCATTAGTGAATGCTATCGGT
    ATTTCGGTTGCACATACAGCTTTAAACTTAAATGTTAAAGCAATTGTAGCTGCTACTGAA
    AGTGGTTCAACGGCACGTACTATCTCTAAATATCGTCCACATTCAGACATTATTGCGGTG
    ACTCCAAGTGAAGAAACAGCACGTCAATGTTCAATTGTTTGGGGAGTTCAACCTGTAGTT
    AAAAAAGGACGTAAGAGTACAGATGCATTGTTAAACAATGCAGTTGCAACAGCTGTTGAA
    ACTGGTAGAGTATCTAATGGTGATTTAATCATTATTACTGCTGGTGTACCAACTGGTGAA
    ACTGGAACTACTAATATGATGAAAATCCACCTAGTTGGTGACGAAATTGCTAATGGTCAA
    GGTATTGGACGTGGATCAGTTGTTGGTACTACGTTAGTTGCTGAAACTGTTAAAGATTTA
    GAAGGTAAAGATTTATCTGACAAAGTTATCGTTACTAACTCAATCGATGAAACGTTTGTA
    CCTTATGTAGAAAAAGCTTTAGGATTAATTACAGAAGAAAATGGTATTACATCACCAAGT
    GCAATTGTTGGTTTAGAAAAAGGTATTCCAACAGTTGTAGGTGTAGAAAAAGCTGTTAAA
    AACATAAGCAATAACATGTTAGTTACGATTGATGCTGCTCAAGGTAAAATCTTTGAAGGA
    TATGCAAACGTACTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1758

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1520 [new locus tag: SA_RS08560 ]
  • symbol: PykA
  • description: pyruvate kinase
  • length: 585
  • theoretical pI: 4.99555
  • theoretical MW: 63101.9
  • GRAVY: -0.127863

Function[edit source | edit]

  • reaction:
    EC 2.7.1.40?  ExPASy
    Pyruvate kinaseATP + pyruvate = ADP + phosphoenolpyruvate
  • TIGRFAM:
    MetabolismEnergy metabolismGlycolysis/gluconeogenesispyruvate kinase (TIGR01064; EC 2.7.1.40; HMM-score: 619.1)
    MetabolismEnergy metabolismGlycolysis/gluconeogenesisphosphoenolpyruvate synthase (TIGR01418; EC 2.7.9.2; HMM-score: 56.3)
    phosphoenolpyruvate-protein phosphotransferase (TIGR01417; EC 2.7.3.9; HMM-score: 27.2)
    2-dehydro-3-deoxyglucarate aldolase (TIGR03239; EC 4.1.2.20; HMM-score: 15.6)
    2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase (TIGR02311; EC 4.1.2.-; HMM-score: 14.4)
  • TheSEED:  
    Fermentations: Mixed acid Pyruvate kinase (EC 2.7.1.40) / Phosphohistidine swiveling domain 
    Glycerate metabolism Pyruvate kinase (EC 2.7.1.40) / Phosphohistidine swiveling domain 
    Glycolysis and Gluconeogenesis Pyruvate kinase (EC 2.7.1.40) / Phosphohistidine swiveling domain 
    Pyruvate metabolism I: anaplerotic reactions, PEP Pyruvate kinase (EC 2.7.1.40) / Phosphohistidine swiveling domain 
  • PFAM:
    PK_TIM (CL0151) PK; Pyruvate kinase, barrel domain (PF00224; HMM-score: 511.6)
    no clan definedPK_C; Pyruvate kinase, alpha/beta domain (PF02887; HMM-score: 127.9)
    Leu-IlvD (CL0364) PEP-utilizers; PEP-utilising enzyme, mobile domain (PF00391; HMM-score: 55.7)
    HTH (CL0123) IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 19)
    PK_TIM (CL0151) HpcH_HpaI; HpcH/HpaI aldolase/citrate lyase family (PF03328; HMM-score: 14.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: K+, Mg2+
  • effectors:
  • protein partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [2] (data from MRSA252)
    SA1533(ackA)acetate kinase  [2] (data from MRSA252)
    SA0562(adh1)alcohol dehydrogenase  [2] (data from MRSA252)
    SA0365(ahpF)alkyl hydroperoxide reductase  [2] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [2] (data from MRSA252)
    SA2427(arcB)ornithine carbamoyltransferase  [2] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [2] (data from MRSA252)
    SA1184(citB)aconitate hydratase  [2] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [2] (data from MRSA252)
    SA1234(cspA)cold-shock protein CspA  [2] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [2] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [2] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA0545(eutD)phosphotransacetylase  [2] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [2] (data from MRSA252)
    SA0505(fus)elongation factor G  [2] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [2] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [2] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [2] (data from MRSA252)
    SA1342(gnd)6-phosphogluconate dehydrogenase  [2] (data from MRSA252)
    SA0376(guaA)GMP synthase  [2] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [2] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA0686(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [2] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [2] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [2] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [2] (data from MRSA252)
    SA0728(pgk)phosphoglycerate kinase  [2] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [2] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [2] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [2] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [2] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [2] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [2] (data from MRSA252)
    SA2040(rplP)50S ribosomal protein L16  [2] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [2] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [2] (data from MRSA252)
    SA2023(rpoA)DNA-directed RNA polymerase subunit alpha  [2] (data from MRSA252)
    SA0500(rpoB)DNA-directed RNA polymerase subunit beta  [2] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [2] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [2] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [2] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [2] (data from MRSA252)
    SA0009(serS)seryl-tRNA synthetase  [2] (data from MRSA252)
    SA0107(spa)immunoglobulin G binding protein A  [2] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [2] (data from MRSA252)
    SA1499(tig)trigger factor  [2] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [2] (data from MRSA252)
    SA0992(trxA)thioredoxin  [2] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [2] (data from MRSA252)
    SA0437hypothetical protein  [2] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [2] (data from MRSA252)
    SA0707hypothetical protein  [2] (data from MRSA252)
    SA0760glycine cleavage system protein H  [2] (data from MRSA252)
    SA0873hypothetical protein  [2] (data from MRSA252)
    SA1271threonine dehydratase  [2] (data from MRSA252)
    SA1272alanine dehydrogenase  [2] (data from MRSA252)
    SA1359elongation factor P  [2] (data from MRSA252)
    SA1532hypothetical protein  [2] (data from MRSA252)
    SA1709hypothetical protein  [2] (data from MRSA252)
    SA2395L-lactate dehydrogenase  [2] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.136
    • Ymax_pos: 23
    • Cmax: 0.134
    • Cmax_pos: 42
    • Smax: 0.256
    • Smax_pos: 1
    • Smean: 0.167
    • D: 0.148
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MRKTKIVCTIGPASESEEMIEKLINAGMNVARLNFSHGSHEEHKGRIDTIRKVAKRLDKIVAILLDTKGPEIRTHNMKDGIIELERGNEVIVSMNEVEGTPEKFSVTYENLINDVQVGSYILLDDGLIELQVKDIDHAKKEVKCDILNSGELKNKKGVNLPGVRVSLPGITEKDAEDIRFGIKENVDFIAASFVRRPSDVLEIREILEEQKANISVFPKIENQEGIDNIAEILEVSDGLMVARGDMGVEIPPEKVPMVQKDLIRQCNKLGKPVITATQMLDSMQRNPRATRAEASDVANAIYDGTDAVMLSGETAAGLYPEEAVKTMRNIAVSAEAAQDYKKLLSDRTKLVETSLVNAIGISVAHTALNLNVKAIVAATESGSTARTISKYRPHSDIIAVTPSEETARQCSIVWGVQPVVKKGRKSTDALLNNAVATAVETGRVSNGDLIIITAGVPTGETGTTNMMKIHLVGDEIANGQGIGRGSVVGTTLVAETVKDLEGKDLSDKVIVTNSIDETFVPYVEKALGLITEENGITSPSAIVGLEKGIPTVVGVEKAVKNISNNMLVTIDAAQGKIFEGYANVL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CcpA
    CcpA (TF) important in Carbon catabolismRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol. Microbiol.: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.50 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.60 2.61 2.62 2.63 2.64 2.65 2.66 2.67 2.68 2.69 2.70 2.71 2.72 2.73 2.74 2.75 2.76 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]