From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0727 [new locus tag: SA_RS04140 ]
  • pan locus tag?: SAUPAN002706000
  • symbol: gap
  • pan gene symbol?: gapA
  • synonym:
  • product: glyceraldehyde-3-phosphate dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0727 [new locus tag: SA_RS04140 ]
  • symbol: gap
  • product: glyceraldehyde-3-phosphate dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 832685..833695
  • length: 1011
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGGCAGTAAAAGTAGCAATTAATGGTTTTGGTAGAATTGGTCGTTTAGCATTCAGAAGA
    ATTCAAGAAGTAGAAGGTCTTGAAGTTGTAGCAGTAAACGACTTAACAGATGACGACATG
    TTAGCGCATTTATTAAAATATGACACTATGCAAGGTCGTTTCACAGGTGAAGTAGAGGTA
    GTTGATGGTGGTTTCCGCGTAAATGGTAAAGAAGTTAAATCATTCAGTGAACCAGATGCA
    AGCAAATTACCTTGGAAAGACTTAAATATCGATGTAGTGTTAGAATGTACTGGTTTCTAC
    ACTGATAAAGATAAAGCACAAGCTCATATTGAAGCAGGCGCTAAAAAAGTATTAATCTCA
    GCACCAGCTACTGGTGACTTAAAAACAATCGTATTCAACACTAACCACCAAGAGTTAGAC
    GGTTCTGAAACAGTTGTTTCAGGTGCTTCATGTACTACAAACTCATTAGCACCAGTTGCT
    AAAGTTTTAAACGATGACTTTGGTTTAGTTGAAGGTTTAATGACTACAATTCACGCTTAC
    ACAGGTGATCAAAATACACAAGACGCACCTCACAGAAAAGGTGACAAACGTCGTGCTCGT
    GCAGCGGCAGAAAACATCATCCCTAACTCAACAGGTGCTGCTAAAGCTATCGGTAAAGTT
    ATTCCTGAAATCGATGGTAAATTAGATGGTGGTGCACAACGTGTTCCTGTAGCTACAGGT
    TCATTAACTGAATTAACAGTAGTATTAGAAAAACAAGACGTAACAGTTGAACAAGTTAAC
    GAAGCTATGAAAAATGCTTCAAACGAATCATTCGGTTACACTGAAGACGAAATCGTTTCT
    TCAGACGTTGTAGGTATGACTTACGGTTCATTATTCGACGCTACACAAACTCGTGTAATG
    TCAGTTGGCGACCGTCAATTAGTTAAAGTTGCAGCTTGGTATGATAACGAAATGTCATAT
    ACTGCACAATTAGTTCGTACATTAGCATACTTAGCTGAACTTTCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1011

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0727 [new locus tag: SA_RS04140 ]
  • symbol: Gap
  • description: glyceraldehyde-3-phosphate dehydrogenase
  • length: 336
  • theoretical pI: 4.64965
  • theoretical MW: 36280.6
  • GRAVY: -0.218155

Function[edit source | edit]

  • reaction:
    EC 1.2.1.12?  ExPASy
    Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)D-glyceraldehyde 3-phosphate + phosphate + NAD+ = 3-phospho-D-glyceroyl phosphate + NADH
  • TIGRFAM:
    MetabolismEnergy metabolismGlycolysis/gluconeogenesisglyceraldehyde-3-phosphate dehydrogenase, type I (TIGR01534; EC 1.2.1.-; HMM-score: 435.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridoxineerythrose-4-phosphate dehydrogenase (TIGR01532; EC 1.2.1.72; HMM-score: 283.8)
    MetabolismAmino acid biosynthesisAspartate familyaspartate-semialdehyde dehydrogenase (TIGR01296; EC 1.2.1.11; HMM-score: 14.4)
    MetabolismAmino acid biosynthesisAspartate familyaspartate-semialdehyde dehydrogenase (TIGR00978; EC 1.2.1.11; HMM-score: 13.4)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismGlycolysis and Gluconeogenesis NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12) 
    Cofactors, Vitamins, Prosthetic Groups, PigmentsPyridoxinePyridoxin (Vitamin B6) Biosynthesis NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12) 
    Stress ResponseOxidative stressGlutaredoxins NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12) 
    Oxidative stressRedox-dependent regulation of nucleus processes NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12) 
  • PFAM:
    GADPH_aa-bio_dh (CL0139) Gp_dh_C; Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain (PF02800; HMM-score: 204)
    NADP_Rossmann (CL0063) Gp_dh_N; Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain (PF00044; HMM-score: 124.2)
    DapB_N; Dihydrodipicolinate reductase, N-terminus (PF01113; HMM-score: 18.2)
    GADPH_aa-bio_dh (CL0139) Semialdhyde_dhC; Semialdehyde dehydrogenase, dimerisation domain (PF02774; HMM-score: 15.7)
    NADP_Rossmann (CL0063) 2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0723(clpP)ATP-dependent Clp protease proteolytic subunit  [2] (data from MRSA252)
    SA1940(deoD)purine nucleoside phosphorylase  [2] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA1074(fabG)3-oxoacyl-ACP reductase  [2] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [2] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SA0865(ppnK)inorganic polyphosphate/ATP-NAD kinase  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA0224hypothetical protein  [2] (data from MRSA252)
    SA1599translaldolase  [2] (data from MRSA252)
    SAS074hypothetical protein  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.124
    • Ymax_pos: 27
    • Cmax: 0.117
    • Cmax_pos: 27
    • Smax: 0.165
    • Smax_pos: 19
    • Smean: 0.117
    • D: 0.121
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAVKVAINGFGRIGRLAFRRIQEVEGLEVVAVNDLTDDDMLAHLLKYDTMQGRFTGEVEVVDGGFRVNGKEVKSFSEPDASKLPWKDLNIDVVLECTGFYTDKDKAQAHIEAGAKKVLISAPATGDLKTIVFNTNHQELDGSETVVSGASCTTNSLAPVAKVLNDDFGLVEGLMTTIHAYTGDQNTQDAPHRKGDKRRARAAAENIIPNSTGAAKAIGKVIPEIDGKLDGGAQRVPVATGSLTELTVVLEKQDVTVEQVNEAMKNASNESFGYTEDEIVSSDVVGMTYGSLFDATQTRVMSVGDRQLVKVAAWYDNEMSYTAQLVRTLAYLAELSK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: GapR
    GapR (TF) important in Glycolysis  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol. Microbiol.: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J. Microbiol. Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)