From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2040 [new locus tag: SA_RS11730 ]
  • pan locus tag?: SAUPAN005695000
  • symbol: rplP
  • pan gene symbol?: rplP
  • synonym:
  • product: 50S ribosomal protein L16

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2040 [new locus tag: SA_RS11730 ]
  • symbol: rplP
  • product: 50S ribosomal protein L16
  • replicon: chromosome
  • strand: -
  • coordinates: 2304011..2304445
  • length: 435
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGTTACTACCAAAACGTGTAAAATATCGTCGTCAACATCGTCCTAAAACAACTGGTCGT
    TCTAAAGGCGGTAACTACGTAACATTTGGTGAGTTTGGTTTACAAGCTACAACAACGTCT
    TGGATCACATCTCGTCAAATCGAATCTGCTCGTATAGCAATGACACGTTACATGAAACGT
    GGCGGGAAAGTTTGGATTAAAATCTTCCCACATACACCATATACTAAAAAACCTTTAGAA
    GTACGTATGGGTGCTGGTAAAGGTGCGGTTGAAGGCTGGATCGCAGTTGTTAAACCAGGT
    AGAATTTTATTCGAAGTTGCTGGCGTTTCTGAAGAAGTTGCGCGTGAAGCACTACGTTTA
    GCAAGTCACAAACTTCCAGTAAAAACTAAGTTTGTAAAACGTGAGGAATTGGGTGGTGAA
    ACAAATGAAAGCTAA
    60
    120
    180
    240
    300
    360
    420
    435

Protein[edit source | edit]

Protein Data Bank: 5LI0
Protein Data Bank: 4WCE
Protein Data Bank: 4WFB
Protein Data Bank: 4WF9
Protein Data Bank: 4WFA
Protein Data Bank: 5HL7

General[edit source | edit]

  • locus tag: SA2040 [new locus tag: SA_RS11730 ]
  • symbol: RplP
  • description: 50S ribosomal protein L16
  • length: 144
  • theoretical pI: 11.3014
  • theoretical MW: 16241.9
  • GRAVY: -0.513889

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uL16 (TIGR01164; HMM-score: 200.8)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uL16 (TIGR00279; HMM-score: 31.9)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisRibosome LSU bacterial LSU ribosomal protein L16p (L10e) 
  • PFAM:
    no clan definedRibosomal_L16; Ribosomal protein L16p/L10e (PF00252; HMM-score: 173.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [2] (data from MRSA252)
    SA1504(infC)translation initiation factor IF-3  [2] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [2] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [2] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [2] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [2] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [2] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [2] (data from MRSA252)
    SA1499(tig)trigger factor  [2] (data from MRSA252)
    SA0295hypothetical protein  [2] (data from MRSA252)
    SA0463hypothetical protein  [2] (data from MRSA252)
    SA0940hypothetical protein  [2] (data from MRSA252)
    SA1528hypothetical protein  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.249
    • Ymax_pos: 11
    • Cmax: 0.122
    • Cmax_pos: 51
    • Smax: 0.71
    • Smax_pos: 8
    • Smean: 0.627
    • D: 0.397
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLLPKRVKYRRQHRPKTTGRSKGGNYVTFGEFGLQATTTSWITSRQIESARIAMTRYMKRGGKVWIKIFPHTPYTKKPLEVRMGAGKGAVEGWIAVVKPGRILFEVAGVSEEVAREALRLASHKLPVKTKFVKREELGGETNES

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26

Relevant publications[edit source | edit]