From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2232 [new locus tag: SACOL_RS11745 ]
  • pan locus tag?: SAUPAN005695000
  • symbol: rplP
  • pan gene symbol?: rplP
  • synonym:
  • product: 50S ribosomal protein L16

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2232 [new locus tag: SACOL_RS11745 ]
  • symbol: rplP
  • product: 50S ribosomal protein L16
  • replicon: chromosome
  • strand: -
  • coordinates: 2302856..2303290
  • length: 435
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGTTACTACCAAAACGTGTAAAATATCGTCGTCAACATCGTCCTAAAACAACTGGTCGT
    TCTAAAGGCGGTAACTACGTAACATTTGGTGAGTTTGGTTTACAAGCTACAACAACGTCT
    TGGATCACATCTCGTCAAATCGAATCTGCTCGTATAGCAATGACACGTTACATGAAACGT
    GGCGGGAAAGTTTGGATTAAAATCTTCCCACATACACCATATACTAAAAAACCTTTAGAA
    GTACGTATGGGTGCTGGTAAAGGTGCGGTTGAAGGCTGGATCGCAGTTGTTAAACCAGGT
    AGAATTTTATTCGAAGTTGCTGGCGTTTCTGAAGAAGTTGCGCGTGAAGCACTACGTTTA
    GCAAGTCACAAACTTCCAGTAAAAACTAAGTTTGTAAAACGTGAGGAATTGGGTGGTGAA
    ACAAATGAAAGCTAA
    60
    120
    180
    240
    300
    360
    420
    435

Protein[edit source | edit]

Protein Data Bank: 5LI0
Protein Data Bank: 4WCE
Protein Data Bank: 4WFB
Protein Data Bank: 4WF9
Protein Data Bank: 4WFA
Protein Data Bank: 5HL7

General[edit source | edit]

  • locus tag: SACOL2232 [new locus tag: SACOL_RS11745 ]
  • symbol: RplP
  • description: 50S ribosomal protein L16
  • length: 144
  • theoretical pI: 11.3014
  • theoretical MW: 16241.9
  • GRAVY: -0.513889

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uL16 (TIGR01164; HMM-score: 200.8)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uL16 (TIGR00279; HMM-score: 31.9)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisRibosome LSU bacterial LSU ribosomal protein L16p (L10e) 
  • PFAM:
    no clan definedRibosomal_L16; Ribosomal protein L16p/L10e (PF00252; HMM-score: 173.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1727(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SACOL1722(tig)trigger factor  [1] (data from MRSA252)
    SACOL03035'-nucleotidase  [1] (data from MRSA252)
    SACOL0549tetrapyrrole methylase  [1] (data from MRSA252)
    SACOL1098hypothetical protein  [1] (data from MRSA252)
    SACOL1753universal stress protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.249
    • Ymax_pos: 11
    • Cmax: 0.122
    • Cmax_pos: 51
    • Smax: 0.71
    • Smax_pos: 8
    • Smean: 0.627
    • D: 0.397
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLLPKRVKYRRQHRPKTTGRSKGGNYVTFGEFGLQATTTSWITSRQIESARIAMTRYMKRGGKVWIKIFPHTPYTKKPLEVRMGAGKGAVEGWIAVVKPGRILFEVAGVSEEVAREALRLASHKLPVKTKFVKREELGGETNES

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4]
    quantitative data / protein copy number per cell: 2028 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 9.54 h [6]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26

Relevant publications[edit source | edit]