From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1769 [new locus tag: SACOL_RS09045 ]
  • pan locus tag?: SAUPAN004372000
  • symbol: rpsD
  • pan gene symbol?: rpsD
  • synonym:
  • product: 30S ribosomal protein S4

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1769 [new locus tag: SACOL_RS09045 ]
  • symbol: rpsD
  • product: 30S ribosomal protein S4
  • replicon: chromosome
  • strand: +
  • coordinates: 1808536..1809138
  • length: 603
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGGCTCGATTCAGAGGTTCAAACTGGAAAAAATCTCGTCGTTTAGGTATCTCTTTAAGC
    GGTACTGGTAAAGAATTAGAAAAACGTCCTTACGCACCAGGACAACATGGTCCAAACCAA
    CGTAAAAAATTATCAGAATATGGTTTACAATTACGTGAAAAACAAAAATTACGTTACTTA
    TATGGAATGACTGAAAGACAATTCCGTAACACATTTGACATCGCTGGTAAAAAATTCGGT
    GTACACGGTGAAAACTTCATGATCTTATTAGCAAGTCGTTTAGACGCTGTTGTTTATTCA
    TTAGGTTTAGCTCGTACTCGTCGTCAAGCACGTCAATTAGTTAACCACGGTCATATCTTA
    GTAGATGGTAAACGTGTTGATATTCCATCTTATTCTGTTAAACCTGGTCAAACAATTTCA
    GTTCGTGAAAAATCTCAAAAATTAAACATCATCGTTGAATCAGTTGAAATCAACAATTTC
    GTACCTGAGTACTTAAACTTTGATGCTGACAGCTTAACTGGTACTTTCGTACGTTTACCA
    GAACGTAGCGAATTACCTGCTGAAATTAACGAACAATTAATCGTTGAGTACTACTCAAGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    603

Protein[edit source | edit]

Protein Data Bank: 5LI0

General[edit source | edit]

  • locus tag: SACOL1769 [new locus tag: SACOL_RS09045 ]
  • symbol: RpsD
  • description: 30S ribosomal protein S4
  • length: 200
  • theoretical pI: 10.559
  • theoretical MW: 23013.2
  • GRAVY: -0.607

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uS4 (TIGR01017; HMM-score: 271.5)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uS4 (TIGR01018; HMM-score: 52.7)
    Unknown functionGeneralTlyA family rRNA methyltransferase/putative hemolysin (TIGR00478; HMM-score: 28)
    Genetic information processingProtein synthesistRNA and rRNA base modificationpseudouridine synthase, RluA family (TIGR00005; EC 5.4.99.-; HMM-score: 14.8)
    MetabolismEnergy metabolismPhotosynthesisphotosystem II S4 domain protein (TIGR03069; HMM-score: 14.8)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisRibosome SSU bacterial SSU ribosomal protein S4p (S9e) 
    CBSS-393130.3.peg.794 SSU ribosomal protein S4p (S9e) 
    CBSS-393130.3.peg.794 SSU ribosomal protein S4p (S9e), zinc-independent 
  • PFAM:
    S4 (CL0492) Ribosomal_S4; Ribosomal protein S4/S9 N-terminal domain (PF00163; HMM-score: 91.5)
    S4; S4 domain (PF01479; HMM-score: 73)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1272(codY)transcriptional repressor CodY  [1] (data from MRSA252)
    SACOL2130(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL1245(fabG1)3-oxoacyl-ACP reductase  [1] (data from MRSA252)
    SACOL2117(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [1] (data from MRSA252)
    SACOL2253(femX)femX protein  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL0961(gluD)glutamate dehydrogenase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1727(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL0033(mecA)penicillin-binding protein 2'  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL0792(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SACOL0841(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL1982(ppaC)manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL0015(rplI)50S ribosomal protein L9  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2232(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL2228(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SACOL1700(rpmA)50S ribosomal protein L27  [1] (data from MRSA252)
    SACOL2231(rpmC)50S ribosomal protein L29  [1] (data from MRSA252)
    SACOL2112(rpmE2)50S ribosomal protein L31  [1] (data from MRSA252)
    SACOL1726(rpmI)50S ribosomal protein L35  [1] (data from MRSA252)
    SACOL0588(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SACOL2120(rpoE)DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL0437(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL2225(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL0591(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SACOL1292(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SACOL1377(tkt)transketolase  [1] (data from MRSA252)
    SACOL03035'-nucleotidase  [1] (data from MRSA252)
    SACOL0521hypothetical protein  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0742hypothetical protein  [1] (data from MRSA252)
    SACOL0815ribosomal subunit interface protein  [1] (data from MRSA252)
    SACOL0876hypothetical protein  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1098hypothetical protein  [1] (data from MRSA252)
    SACOL1426hypothetical protein  [1] (data from MRSA252)
    SACOL1588proline dipeptidase  [1] (data from MRSA252)
    SACOL1651hypothetical protein  [1] (data from MRSA252)
    SACOL1753universal stress protein  [1] (data from MRSA252)
    SACOL1777serine protease HtrA  [1] (data from MRSA252)
    SACOL1788hypothetical protein  [1] (data from MRSA252)
    SACOL2072DEAD/DEAH box helicase  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.223
    • Ymax_pos: 11
    • Cmax: 0.115
    • Cmax_pos: 35
    • Smax: 0.632
    • Smax_pos: 5
    • Smean: 0.519
    • D: 0.338
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MARFRGSNWKKSRRLGISLSGTGKELEKRPYAPGQHGPNQRKKLSEYGLQLREKQKLRYLYGMTERQFRNTFDIAGKKFGVHGENFMILLASRLDAVVYSLGLARTRRQARQLVNHGHILVDGKRVDIPSYSVKPGQTISVREKSQKLNIIVESVEINNFVPEYLNFDADSLTGTFVRLPERSELPAEINEQLIVEYYSR

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4]
    quantitative data / protein copy number per cell: 3371 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 9.67 h [6]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75

Relevant publications[edit source | edit]