From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1777 [new locus tag: SACOL_RS09095 ]
  • pan locus tag?: SAUPAN004387000
  • symbol: SACOL1777
  • pan gene symbol?: htrA1
  • synonym:
  • product: serine protease HtrA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1777 [new locus tag: SACOL_RS09095 ]
  • symbol: SACOL1777
  • product: serine protease HtrA
  • replicon: chromosome
  • strand: +
  • coordinates: 1817258..1818532
  • length: 1275
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGTCAGATTTTAATCATACAGATCATTCTACAACAAACCATAGCCAAACACCTAGATAC
    AGAAGACCTAAATTTCCATGGTTTAAAACAGTCATCGTTGCATTGATTGCTGGAATTATT
    GGTGCACTTCTAGTACTTGGTATAGGCAAAGTATTAAATAGTACAATTTTAAATAAAGAT
    GGTTCAACTGTTCAGACAACAAATAATAAAGGTGGCAATCAATTAGACGGTCAAAGCAAG
    AAATTCGGTACCGTTCATGAAATGATAAAATCTGTCTCCCCTACAATTGTTGGAGTTATT
    AACATGCAAAAAGCATCAAGTGTAGACGACTTATTAAAAGGCAAATCATCTAAACCATCT
    GAAGCTGGAGTAGGTTCAGGTGTTATCTATCAAATAAACAACAATTCAGCTTATATCGTT
    ACAAACAATCATGTTATTGATGGCGCAAATGAAATTAGAGTCCAATTACATAATAAAAAA
    CAAGTTAAAGCGAAATTAGTTGGTAAAGATGCAGTAACTGATATTGCTGTACTTAAAATT
    GAAAATACAAAAGGTATTAAAGCGATTCAATTTGCCAACTCTTCAAAAGTACAAACTGGC
    GATAGCGTATTCGCAATGGGTAACCCATTAGGATTACAATTTGCTAACTCTGTAACATCT
    GGTATCATTTCAGCAAGCGAACGTACGATTGACGCTGAGACAACTGGTGGCAATACAAAA
    GTTAGCGTTCTTCAAACAGATGCTGCTATTAACCCAGGTAACTCAGGTGGCGCATTAGTA
    GATATTAATGGTAATTTAGTTGGTATTAACTCAATGAAAATTGCTGCGACACAAGTTGAA
    GGTATCGGGTTTGCTATTCCAAGTAATGAAGTTAAAGTAACAATTGAACAACTTGTAAAA
    CATGGTAAAATTGACCGCCCTTCGATTGGTATTGGTTTAATTAATTTGAAAGATATTCCT
    GAAGAAGAGCGCGAGCAACTTCATACTGATAGAGAAGACGGTATTTATGTCGCCAAAGCT
    GATAGTGATATTGATCTTAAAAAAGGTGATATTATTACAGAAATTGATGGCAAGAAAATT
    AAAGATGATGTTGATTTAAGAAGCTATTTATATGAAAATAAAAAACCTGGTGAATCAGTC
    ACTGTTACCGTTATCCGTGATGGTAAAACAAAAGAAGTTAAAGTGAAATTAAAACAACAA
    AAAGAACAACCAAAACGTCAAAGCCGATCAGAACGTCAATCACCTGGCCAAGGCGATAGA
    GATTTCTTTAGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1275

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1777 [new locus tag: SACOL_RS09095 ]
  • symbol: SACOL1777
  • description: serine protease HtrA
  • length: 424
  • theoretical pI: 9.97226
  • theoretical MW: 45802.6
  • GRAVY: -0.416981

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidespeptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 291.6)
    Genetic information processingProtein fateProtein folding and stabilizationpeptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 291.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesperiplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 182.6)
    Signal transductionRegulatory functionsProtein interactionsperiplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 182.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesRIP metalloprotease RseP (TIGR00054; EC 3.4.24.-; HMM-score: 19)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype II secretion system protein C (TIGR01713; HMM-score: 16.6)
  • TheSEED:  
    Serine protease, DegP/HtrA, do-like (EC 3.4.21.-) 
  • PFAM:
    Peptidase_PA (CL0124) Trypsin_2; Trypsin-like peptidase domain (PF13365; HMM-score: 109.3)
    Trypsin; Trypsin (PF00089; HMM-score: 59.8)
    PDZ-like (CL0466) PDZ_2; PDZ domain (PF13180; HMM-score: 57.6)
    Tricorn_PDZ; Tricorn protease PDZ domain (PF14685; HMM-score: 22)
    Peptidase_PA (CL0124) Peptidase_S32; Equine arteritis virus serine endopeptidase S32 (PF05579; HMM-score: 17.3)
    PDZ-like (CL0466) PDZ; PDZ domain (Also known as DHR or GLGF) (PF00595; HMM-score: 15.6)
    Peptidase_PA (CL0124) DUF31; Putative peptidase (DUF31) (PF01732; HMM-score: 14)
    His_Kinase_A (CL0025) HATPase_c_5; GHKL domain (PF14501; HMM-score: 11.9)
    Peptidase_PA (CL0124) Peptidase_S46; Peptidase S46 (PF10459; HMM-score: 4.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1760(ackA)acetate kinase  [1] (data from MRSA252)
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL2654(arcC2)carbamate kinase  [1] (data from MRSA252)
    SACOL1721(clpX)ATP-dependent protease ATP-binding subunit ClpX  [1] (data from MRSA252)
    SACOL1223(coaBC)phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SACOL0173(ipdC)indole-3-pyruvate decarboxylase  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL1453(murG)UDPdiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase  [1] (data from MRSA252)
    SACOL0792(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SACOL1699(obgE)GTPase ObgE  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0544(prsA)ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    SACOL0539(purR)pur operon repressor  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL1277(pyrH)uridylate kinase  [1] (data from MRSA252)
    SACOL1304(recA)recombinase A  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SACOL2229(rplN)50S ribosomal protein L14  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2232(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    SACOL2223(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL0588(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL2057(rsbU)sigma factor B regulator protein  [1] (data from MRSA252)
    SACOL0816(secA)preprotein translocase subunit SecA  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SACOL0238teichoic acid biosynthesis protein  [1] (data from MRSA252)
    SACOL0599hypothetical protein  [1] (data from MRSA252)
    SACOL0941  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1753universal stress protein  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL1788hypothetical protein  [1] (data from MRSA252)
    SACOL1951Mur ligase  [1] (data from MRSA252)
    SACOL2072DEAD/DEAH box helicase  [1] (data from MRSA252)
    SACOL2156ATP-binding Mrp/Nbp35 family protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helix: 1
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.179
    • Ymax_pos: 33
    • Cmax: 0.124
    • Cmax_pos: 54
    • Smax: 0.444
    • Smax_pos: 29
    • Smean: 0.23
    • D: 0.199
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSDFNHTDHSTTNHSQTPRYRRPKFPWFKTVIVALIAGIIGALLVLGIGKVLNSTILNKDGSTVQTTNNKGGNQLDGQSKKFGTVHEMIKSVSPTIVGVINMQKASSVDDLLKGKSSKPSEAGVGSGVIYQINNNSAYIVTNNHVIDGANEIRVQLHNKKQVKAKLVGKDAVTDIAVLKIENTKGIKAIQFANSSKVQTGDSVFAMGNPLGLQFANSVTSGIISASERTIDAETTGGNTKVSVLQTDAAINPGNSGGALVDINGNLVGINSMKIAATQVEGIGFAIPSNEVKVTIEQLVKHGKIDRPSIGIGLINLKDIPEEEREQLHTDREDGIYVAKADSDIDLKKGDIITEIDGKKIKDDVDLRSYLYENKKPGESVTVTVIRDGKTKEVKVKLKQQKEQPKRQSRSERQSPGQGDRDFFR

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL1777 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]