From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1105 [new locus tag: SACOL_RS05645 ]
  • pan locus tag?: SAUPAN003320000
  • symbol: pdhD
  • pan gene symbol?: pdhD
  • synonym:
  • product: dihydrolipoamide dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1105 [new locus tag: SACOL_RS05645 ]
  • symbol: pdhD
  • product: dihydrolipoamide dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 1115550..1116956
  • length: 1407
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGTAGTTGGAGATTTCCCAATTGAAACAGATACTATAGTAATCGGAGCAGGTCCTGGT
    GGATACGTTGCAGCAATTCGTGCAGCTCAATTAGGACAAAAAGTAACAATCGTTGAGAAA
    GGTAATCTTGGTGGTGTTTGCTTAAACGTAGGATGTATTCCTTCAAAAGCATTACTACAT
    GCTTCTCACCGTTTTGTTGAAGCACAACATTCTGAAAACTTAGGTGTTATTGCTGAAAGT
    GTTTCTTTAAACTTCCAAAAAGTTCAAGAATTCAAATCATCAGTTGTTAATAAATTAACT
    GGTGGTGTTGAAGGCTTACTTAAAGGTAACAAAGTTAACATCGTTAAAGGTGAAGCATAT
    TTCGTAGATAACAATAGCTTACGTGTTATGGACGAAAAGAGCGCACAAACATACAACTTT
    AAAAATGCAATCATTGCAACAGGTTCAAGACCAATTGAAATTCCTAATTTCAAATTCGGT
    AAACGTGTTATCGACTCAACAGGTGCTTTAAACTTACAAGAAGTACCAGGTAAATTAGTT
    GTAGTTGGTGGAGGATACATTGGATCAGAATTAGGTACAGCATTTGCTAACTTTGGTTCA
    GAAGTAACCATCCTTGAAGGTGCTAAAGATATCTTAGGTGGCTTCGAAAAACAAATGACA
    CAACCTGTTAAAAAAGGTATGAAAGAAAAAGGTGTTGAAATCGTTACTGAAGCTATGGCT
    AAATCAGCTGAAGAAACAGATAACGGAGTTAAAGTTACTTATGAAGCTAAAGGCGAAGAG
    AAAACAATCGAAGCTGATTATGTATTAGTAACTGTAGGTCGTCGTCCAAACACAGACGAA
    TTAGGCCTAGAAGAATTAGGTGTTAAATTCGCTGACCGTGGATTATTAGAAGTTGATAAA
    CAAAGCCGTACGTCTATCAGCAATATCTATGCAATTGGTGATATCGTTCCAGGTTTACCA
    CTTGCTCACAAAGCTAGCTATGAAGCTAAAGTTGCTGCTGAAGCAATTGATGGTCAAGCT
    GCTGAAGTTGATTACATTGGTATGCCAGCAGTATGCTTTACTGAACCAGAATTAGCTACA
    GTTGGTTATTCAGAAGCGCAAGCTAAAGAAGAAGGTTTAGCAATTAAAGCTTCTAAATTC
    CCATATGCAGCAAATGGTCGTGCATTATCATTAGATGATACTAACGGATTTGTTAAACTT
    ATTACACTTAAAGAAGATGATACTTTAATCGGTGCTCAAGTAGTTGGTACTGGTGCATCA
    GATATTATCTCTGAATTAGGTTTAGCAATTGAAGCTGGTATGAATGCTGAAGATATCGCA
    TTAACAATCCATGCACATCCAACATTAGGTGAGATGACTATGGAAGCAGCAGAAAAAGCT
    ATCGGATACCCAATCCATACAATGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1407

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1105 [new locus tag: SACOL_RS05645 ]
  • symbol: PdhD
  • description: dihydrolipoamide dehydrogenase
  • length: 468
  • theoretical pI: 4.66989
  • theoretical MW: 49451
  • GRAVY: -0.00641026

Function[edit source | edit]

  • reaction:
    EC 1.8.1.4?  ExPASy
    Dihydrolipoyl dehydrogenaseProtein N6-(dihydrolipoyl)lysine + NAD+ = protein N6-(lipoyl)lysine + NADH
  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 565.5)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 369.4)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 286.6)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 257.6)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 247.1)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 213.5)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 161.1)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 115.3)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 64.6)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 56.6)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 56)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 48.8)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 42.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 41.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 38.3)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 38.1)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 37.9)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 34.7)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 32.3)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 27.8)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 21.6)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 20.5)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 19)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 17.2)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 16.3)
    lycopene cyclase family protein (TIGR01790; HMM-score: 15.9)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 15.7)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 15.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 15)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 14.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 13.4)
    MetabolismEnergy metabolismAmino acids and aminesalanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 12.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 11.2)
    MetabolismEnergy metabolismOther4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 11.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 11)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercarotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 10.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 8.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 7.6)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 6.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 4.7)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismDehydrogenase complexes Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) 
    Central carbohydrate metabolismPyruvate metabolism II: acetyl-CoA, acetogenesis from pyruvate Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) 
    Central carbohydrate metabolismTCA Cycle Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) 
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 244.3)
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 118.2)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 75)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 47.3)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 39.4)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 29.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 28.7)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 28.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 26.9)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 20.8)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 20.7)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 18.7)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 17.2)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 15.6)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 15)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 14.5)
    Thi4; Thi4 family (PF01946; HMM-score: 13.4)
    no clan definedDUF4150; Domain of unknown function (DUF4150) (PF13665; HMM-score: 12.3)
    NADP_Rossmann (CL0063) Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.3)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 10.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:
    SACOL1760(ackA)acetate kinase  [1] (data from MRSA252)
    SACOL0660(adhP)alcohol dehydrogenase  [1] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL2656(arcB2)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [1] (data from MRSA252)
    SACOL1800(dat)D-alanine aminotransferase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL0634(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [1] (data from MRSA252)
    SACOL1782(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL0961(gluD)glutamate dehydrogenase  [1] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SACOL2017(groES)co-chaperonin GroES  [1] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SACOL2618(ldh2)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SACOL0839(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SACOL0841(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL1982(ppaC)manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SACOL1092(ptsI)phosphoenolpyruvate-protein phosphotransferase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2232(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SACOL1700(rpmA)50S ribosomal protein L27  [1] (data from MRSA252)
    SACOL2221(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SACOL2112(rpmE2)50S ribosomal protein L31  [1] (data from MRSA252)
    SACOL1726(rpmI)50S ribosomal protein L35  [1] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SACOL2120(rpoE)DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0437(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL2225(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SACOL1254(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SACOL2056(rsbV)anti-anti-sigma factor RsbV  [1] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [1] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL1262(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SACOL1831(tal)translaldolase  [1] (data from MRSA252)
    SACOL1729(thrS)threonyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1722(tig)trigger factor  [1] (data from MRSA252)
    SACOL1377(tkt)transketolase  [1] (data from MRSA252)
    SACOL0840(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SACOL0457hypothetical protein  [1] (data from MRSA252)
    SACOL0506ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SACOL0521hypothetical protein  [1] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SACOL0688ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SACOL0815ribosomal subunit interface protein  [1] (data from MRSA252)
    SACOL0875thioredoxin  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [1] (data from MRSA252)
    SACOL1020hypothetical protein  [1] (data from MRSA252)
    SACOL1437CSD family cold shock protein  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL1952ferritins family protein  [1] (data from MRSA252)
    SACOL2131Dps family protein  [1] (data from MRSA252)
    SACOL25691-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.127
    • Ymax_pos: 40
    • Cmax: 0.13
    • Cmax_pos: 25
    • Smax: 0.173
    • Smax_pos: 37
    • Smean: 0.097
    • D: 0.115
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MVVGDFPIETDTIVIGAGPGGYVAAIRAAQLGQKVTIVEKGNLGGVCLNVGCIPSKALLHASHRFVEAQHSENLGVIAESVSLNFQKVQEFKSSVVNKLTGGVEGLLKGNKVNIVKGEAYFVDNNSLRVMDEKSAQTYNFKNAIIATGSRPIEIPNFKFGKRVIDSTGALNLQEVPGKLVVVGGGYIGSELGTAFANFGSEVTILEGAKDILGGFEKQMTQPVKKGMKEKGVEIVTEAMAKSAEETDNGVKVTYEAKGEEKTIEADYVLVTVGRRPNTDELGLEELGVKFADRGLLEVDKQSRTSISNIYAIGDIVPGLPLAHKASYEAKVAAEAIDGQAAEVDYIGMPAVCFTEPELATVGYSEAQAKEEGLAIKASKFPYAANGRALSLDDTNGFVKLITLKEDDTLIGAQVVGTGASDIISELGLAIEAGMNAEDIALTIHAHPTLGEMTMEAAEKAIGYPIHTM

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4] [5]
    quantitative data / protein copy number per cell: 7736 [6]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 28.55 h [7]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  6. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  7. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol. Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]