From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS05645 [old locus tag: SACOL1105 ]
  • pan locus tag?: SAUPAN003320000
  • symbol: SACOL_RS05645
  • pan gene symbol?: pdhD
  • synonym:
  • product: dihydrolipoyl dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS05645 [old locus tag: SACOL1105 ]
  • symbol: SACOL_RS05645
  • product: dihydrolipoyl dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 1115550..1116956
  • length: 1407
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1115550..1116956) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGTAGTTGGAGATTTCCCAATTGAAACAGATACTATAGTAATCGGAGCAGGTCCTGGT
    GGATACGTTGCAGCAATTCGTGCAGCTCAATTAGGACAAAAAGTAACAATCGTTGAGAAA
    GGTAATCTTGGTGGTGTTTGCTTAAACGTAGGATGTATTCCTTCAAAAGCATTACTACAT
    GCTTCTCACCGTTTTGTTGAAGCACAACATTCTGAAAACTTAGGTGTTATTGCTGAAAGT
    GTTTCTTTAAACTTCCAAAAAGTTCAAGAATTCAAATCATCAGTTGTTAATAAATTAACT
    GGTGGTGTTGAAGGCTTACTTAAAGGTAACAAAGTTAACATCGTTAAAGGTGAAGCATAT
    TTCGTAGATAACAATAGCTTACGTGTTATGGACGAAAAGAGCGCACAAACATACAACTTT
    AAAAATGCAATCATTGCAACAGGTTCAAGACCAATTGAAATTCCTAATTTCAAATTCGGT
    AAACGTGTTATCGACTCAACAGGTGCTTTAAACTTACAAGAAGTACCAGGTAAATTAGTT
    GTAGTTGGTGGAGGATACATTGGATCAGAATTAGGTACAGCATTTGCTAACTTTGGTTCA
    GAAGTAACCATCCTTGAAGGTGCTAAAGATATCTTAGGTGGCTTCGAAAAACAAATGACA
    CAACCTGTTAAAAAAGGTATGAAAGAAAAAGGTGTTGAAATCGTTACTGAAGCTATGGCT
    AAATCAGCTGAAGAAACAGATAACGGAGTTAAAGTTACTTATGAAGCTAAAGGCGAAGAG
    AAAACAATCGAAGCTGATTATGTATTAGTAACTGTAGGTCGTCGTCCAAACACAGACGAA
    TTAGGCCTAGAAGAATTAGGTGTTAAATTCGCTGACCGTGGATTATTAGAAGTTGATAAA
    CAAAGCCGTACGTCTATCAGCAATATCTATGCAATTGGTGATATCGTTCCAGGTTTACCA
    CTTGCTCACAAAGCTAGCTATGAAGCTAAAGTTGCTGCTGAAGCAATTGATGGTCAAGCT
    GCTGAAGTTGATTACATTGGTATGCCAGCAGTATGCTTTACTGAACCAGAATTAGCTACA
    GTTGGTTATTCAGAAGCGCAAGCTAAAGAAGAAGGTTTAGCAATTAAAGCTTCTAAATTC
    CCATATGCAGCAAATGGTCGTGCATTATCATTAGATGATACTAACGGATTTGTTAAACTT
    ATTACACTTAAAGAAGATGATACTTTAATCGGTGCTCAAGTAGTTGGTACTGGTGCATCA
    GATATTATCTCTGAATTAGGTTTAGCAATTGAAGCTGGTATGAATGCTGAAGATATCGCA
    TTAACAATCCATGCACATCCAACATTAGGTGAGATGACTATGGAAGCAGCAGAAAAAGCT
    ATCGGATACCCAATCCATACAATGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1407

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS05645 [old locus tag: SACOL1105 ]
  • symbol: SACOL_RS05645
  • description: dihydrolipoyl dehydrogenase
  • length: 468
  • theoretical pI: 4.66989
  • theoretical MW: 49451
  • GRAVY: -0.00641026

Function[edit source | edit]

  • reaction:
    EC 1.8.1.4?  ExPASy
    Dihydrolipoyl dehydrogenaseProtein N6-(dihydrolipoyl)lysine + NAD+ = protein N6-(lipoyl)lysine + NADH
  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 565.5)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 369.4)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 286.6)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 257.6)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 247.1)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 213.5)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 161.1)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 115.3)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 64.6)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 56.6)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 56)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 48.8)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 42.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 41.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 38.3)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 38.1)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 37.9)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 34.7)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 32.3)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 27.8)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 21.6)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 20.5)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 19)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 17.2)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 16.3)
    lycopene cyclase family protein (TIGR01790; HMM-score: 15.9)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 15.7)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 15.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 15)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 14.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 13.4)
    MetabolismEnergy metabolismAmino acids and aminesalanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 12.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 11.2)
    MetabolismEnergy metabolismOther4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 11.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 11)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercarotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 10.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 8.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 7.6)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 6.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 4.7)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 244.3)
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 118.2)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 75)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 47.3)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 39.4)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 29.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 28.7)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 28.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 26.9)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 20.8)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 20.7)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 18.7)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 17.2)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 15.6)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 15)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 14.5)
    Thi4; Thi4 family (PF01946; HMM-score: 13.4)
    no clan definedDUF4150; Domain of unknown function (DUF4150) (PF13665; HMM-score: 12.3)
    NADP_Rossmann (CL0063) Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.3)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 10.7)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.127
    • Ymax_pos: 40
    • Cmax: 0.13
    • Cmax_pos: 25
    • Smax: 0.173
    • Smax_pos: 37
    • Smean: 0.097
    • D: 0.115
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446182262 NCBI
  • RefSeq: WP_000260117 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MVVGDFPIETDTIVIGAGPGGYVAAIRAAQLGQKVTIVEKGNLGGVCLNVGCIPSKALLHASHRFVEAQHSENLGVIAESVSLNFQKVQEFKSSVVNKLTGGVEGLLKGNKVNIVKGEAYFVDNNSLRVMDEKSAQTYNFKNAIIATGSRPIEIPNFKFGKRVIDSTGALNLQEVPGKLVVVGGGYIGSELGTAFANFGSEVTILEGAKDILGGFEKQMTQPVKKGMKEKGVEIVTEAMAKSAEETDNGVKVTYEAKGEEKTIEADYVLVTVGRRPNTDELGLEELGVKFADRGLLEVDKQSRTSISNIYAIGDIVPGLPLAHKASYEAKVAAEAIDGQAAEVDYIGMPAVCFTEPELATVGYSEAQAKEEGLAIKASKFPYAANGRALSLDDTNGFVKLITLKEDDTLIGAQVVGTGASDIISELGLAIEAGMNAEDIALTIHAHPTLGEMTMEAAEKAIGYPIHTM

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS05645 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103

Relevant publications[edit source | edit]