From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS11660 [old locus tag: SACOL2215 ]
  • pan locus tag?: SAUPAN005678000
  • symbol: SACOL_RS11660
  • pan gene symbol?: rpsM
  • synonym:
  • product: 30S ribosomal protein S13

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS11660 [old locus tag: SACOL2215 ]
  • symbol: SACOL_RS11660
  • product: 30S ribosomal protein S13
  • replicon: chromosome
  • strand: -
  • coordinates: 2295388..2295753
  • length: 366
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2295388..2295753) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGCACGTATTGCAGGAGTAGATATTCCACGTGAAAAACGCGTAGTTATCTCATTAACT
    TATATATACGGTATCGGTACGTCAACTGCTCAAAAAATTCTTGAAGAAGCTAACGTATCA
    GCTGATACTCGTGTGAAAGATTTAACTGATGACGAATTAGGTCGCATCCGTGAAGTTGTA
    GACGGTTATAAAGTCGAAGGTGACTTACGTCGTGAAACTAACTTAAATATCAAACGTTTA
    ATGGAAATTTCATCATACCGTGGTATCCGTCACCGTCGTGGTTTACCAGTTCGTGGTCAA
    AAAACGAAAAACAACGCGCGTACTCGTAAAGGACCAGTTAAAACGGTAGCTAACAAGAAA
    AAATAA
    60
    120
    180
    240
    300
    360
    366

Protein[edit source | edit]

Protein Data Bank: 5LI0

General[edit source | edit]

  • locus tag: SACOL_RS11660 [old locus tag: SACOL2215 ]
  • symbol: SACOL_RS11660
  • description: 30S ribosomal protein S13
  • length: 121
  • theoretical pI: 11.0712
  • theoretical MW: 13718.7
  • GRAVY: -0.733884

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uS13 (TIGR03631; HMM-score: 177.1)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uS13 (TIGR03629; HMM-score: 76.4)
  • TheSEED:
  • PFAM:
    H2TH (CL0303) Ribosomal_S13; Ribosomal protein S13/S18 (PF00416; HMM-score: 121.7)
    HHH (CL0198) HHH_6; Helix-hairpin-helix motif (PF14579; HMM-score: 14)
    H2TH (CL0303) FbpA; Fibronectin-binding protein A N-terminus (FbpA) (PF05833; HMM-score: 13.7)
    HHH (CL0198) DNA_pol_lambd_f; Fingers domain of DNA polymerase lambda (PF10391; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.17
    • Ymax_pos: 42
    • Cmax: 0.162
    • Cmax_pos: 42
    • Smax: 0.303
    • Smax_pos: 32
    • Smean: 0.128
    • D: 0.153
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446012941 NCBI
  • RefSeq: WP_000090796 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MARIAGVDIPREKRVVISLTYIYGIGTSTAQKILEEANVSADTRVKDLTDDELGRIREVVDGYKVEGDLRRETNLNIKRLMEISSYRGIRHRRGLPVRGQKTKNNARTRKGPVKTVANKKK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS11660 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17

Relevant publications[edit source | edit]