From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0973 [new locus tag: SACOL_RS04980 ]
  • pan locus tag?: SAUPAN003078000
  • symbol: SACOL0973
  • pan gene symbol?:
  • synonym:
  • product: fumarylacetoacetate hydrolase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0973 [new locus tag: SACOL_RS04980 ]
  • symbol: SACOL0973
  • product: fumarylacetoacetate hydrolase
  • replicon: chromosome
  • strand: +
  • coordinates: 979278..980180
  • length: 903
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAAATTCTTATCATTCAAGTATAATGACAAAACTTCATATGGCGTTAAAGTAAAACGC
    GAAGATGCTGTATGGGATTTAACACAAGTATTTGCTGACTTTGCAGAAGGAGATTTCCAT
    CCTAAAACATTGTTAGCTGGTTTACAACAAAATCATACTTTAGATTTTCAAGAACAAGTA
    CGTAAAGCAGTTGTAGCAGCAGAAGATAGCGGCAAAGCTGAAGACTATAAAATTTCATTT
    AATGACATTGAATTTTTACCACCAGTAACACCTCCGAATAATGTGATTGCTTTTGGTAGA
    AATTACAAAGATCATGCGAACGAATTAAATCATGAAGTGGAAAAATTATATGTATTTACA
    AAAGCAGCGTCATCTTTAACAGGAGATAATGCAACAATTCCAAATCATAAAGATATTACT
    GATCAATTAGATTATGAAGGTGAATTAGGTATTGTTATTGGTAAGTCTGGTGAAAAGATT
    CCAAAAGCATTAGCTTTAGATTATGTTTACGGCTATACAATTATTAACGATATCACTGAT
    CGCAAAGCACAAAGTGAACAAGATCAAGCATTTTTATCAAAAAGTTTAACTGGCGGTTGC
    CCAATGGGTCCTTATATCGTTACTAAAGACGAACTACCATTACCTGAAAATGTAAATATT
    GTTACAAAAGTTAACAATGAAATTAGACAAGATGGTAACACTGGCGAAATGATTCTTAAA
    ATTGATGAATTAATAGAAGAAATTTCAAAATATGTTGCACTACATCCGGGAGATATTATT
    GCAACTGGTACACCAGCAGGCGTTGGTGCAGGTATGCAACCACCTAAATTTTTACAACCA
    GGTGATGAAGTTAAAGTGACTATTGATAATATTGGAACGCTGACAACTTATATCGCTAAA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    903

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0973 [new locus tag: SACOL_RS04980 ]
  • symbol: SACOL0973
  • description: fumarylacetoacetate hydrolase
  • length: 300
  • theoretical pI: 4.60314
  • theoretical MW: 33113.1
  • GRAVY: -0.368667

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase, C-terminal subunit (TIGR02303; EC 4.1.1.68,5.3.3.10; HMM-score: 174.5)
    4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase, N-terminal subunit (TIGR02305; EC 4.1.1.68,5.3.3.10; HMM-score: 96.8)
    MetabolismEnergy metabolismAmino acids and aminesfumarylacetoacetase (TIGR01266; EC 3.7.1.2; HMM-score: 18.5)
  • TheSEED:  
    Metabolism of Aromatic CompoundsMetabolism of Aromatic Compounds - no subcategoryGentisate degradation Fumarylacetoacetate hydrolase family protein 
    Metabolism of central aromatic intermediatesSalicylate and gentisate catabolism Fumarylacetoacetate hydrolase family protein 
  • PFAM:
    FAH (CL0377) FAA_hydrolase; Fumarylacetoacetate (FAA) hydrolase family (PF01557; HMM-score: 206)
    KH (CL0007) KH_2; KH domain (PF07650; HMM-score: 14.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1760(ackA)acetate kinase  [1] (data from MRSA252)
    SACOL1385(acnA)aconitate hydratase  [1] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL2656(arcB2)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SACOL1494(asnC)asparaginyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL0833(clpP)ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [1] (data from MRSA252)
    SACOL2130(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL0634(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [1] (data from MRSA252)
    SACOL1782(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL1961(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL0961(gluD)glutamate dehydrogenase  [1] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SACOL2415(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [1] (data from MRSA252)
    SACOL0461(guaA)GMP synthase  [1] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL2618(ldh2)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL0562(lysS)lysyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL2116(murAB)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1746(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SACOL0839(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SACOL2223(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL2228(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SACOL1700(rpmA)50S ribosomal protein L27  [1] (data from MRSA252)
    SACOL2221(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SACOL2112(rpmE2)50S ribosomal protein L31  [1] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SACOL1516(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0437(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL2225(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SACOL1254(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [1] (data from MRSA252)
    SACOL1263(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    SACOL1722(tig)trigger factor  [1] (data from MRSA252)
    SACOL1377(tkt)transketolase  [1] (data from MRSA252)
    SACOL0840(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SACOL0688ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SACOL0708DAK2 domain-containing protein  [1] (data from MRSA252)
    SACOL0914FeS assembly ATPase SufC  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1753universal stress protein  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL1952ferritins family protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)
    SACOL2293NAD/NADP octopine/nopaline dehydrogenase  [1] (data from MRSA252)
    SACOL2553pyruvate oxidase  [1] (data from MRSA252)
    SACOL25691-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.142
    • Ymax_pos: 11
    • Cmax: 0.152
    • Cmax_pos: 33
    • Smax: 0.244
    • Smax_pos: 7
    • Smean: 0.202
    • D: 0.165
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKFLSFKYNDKTSYGVKVKREDAVWDLTQVFADFAEGDFHPKTLLAGLQQNHTLDFQEQVRKAVVAAEDSGKAEDYKISFNDIEFLPPVTPPNNVIAFGRNYKDHANELNHEVEKLYVFTKAASSLTGDNATIPNHKDITDQLDYEGELGIVIGKSGEKIPKALALDYVYGYTIINDITDRKAQSEQDQAFLSKSLTGGCPMGPYIVTKDELPLPENVNIVTKVNNEIRQDGNTGEMILKIDELIEEISKYVALHPGDIIATGTPAGVGAGMQPPKFLQPGDEVKVTIDNIGTLTTYIAK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4] [5]
    quantitative data / protein copy number per cell: 3270 [6]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 31.18 h [7]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104

Relevant publications[edit source | edit]