From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1385 [new locus tag: SACOL_RS07050 ]
  • pan locus tag?: SAUPAN003735000
  • symbol: acnA
  • pan gene symbol?: citB
  • synonym:
  • product: aconitate hydratase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1385 [new locus tag: SACOL_RS07050 ]
  • symbol: acnA
  • product: aconitate hydratase
  • replicon: chromosome
  • strand: +
  • coordinates: 1390934..1393639
  • length: 2706
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    ATGGCTGCAAATTTTAAAGAGCAATCAAAAAAACATTTTGACTTGAATGGCCAAAGTTAT
    ACTTACTATGATTTAAAAGCTGTAGAAGAGCAAGGTATTACTAAAGTTTCCAATTTACCT
    TATTCAATTCGTGTTTTGTTAGAATCTTTACTTCGTCAAGAAGATGATTTTGTAATTACA
    GACGATCATATTAAAGCTTTAAGTCAGTTTGGAAAAGATGGAAATGAAGGCGAGGTACCA
    TTTAAACCTTCTCGTGTTATTTTACAAGATTTCACAGGTGTACCAGCCGTAGTTGATTTA
    GCTTCTTTACGTAAAGCAATGGATGACGTTGGGGGAGATATTACTAAAATTAATCCAGAA
    GTACCGGTGGATTTAGTTATTGACCACTCAGTTCAAGTGGATAGCTATGCAAATCCAGAA
    GCTCTTGAACGTAATATGAAATTAGAATTTGAACGTAACTATGAACGTTATCAGTTTTTA
    AATTGGGCAACGAAAGCATTTGATAATTACAATGCAGTTCCTCCTGCAACTGGAATAGTT
    CACCAAGTTAACTTAGAATATTTAGCAAGTGTTGTACATGTTCGTGATGTAGATGGTGAA
    AAAACTGCATTTCCAGATACATTAGTTGGTACTGATTCACATACAACAATGATAAATGGT
    ATTGGCGTACTAGGATGGGGTGTTGGTGGTATTGAAGCTGAAGCTGGAATGCTTGGACAA
    CCTTCTTATTTCCCAATTCCAGAGGTTATTGGTGTACGACTAGTAAATTCATTACCACAA
    GGCGCAACAGCAACTGATTTAGCGTTAAGAGTAACTCAAGAGCTACGTAAAAAAGGTGTT
    GTTGGTAAATTTGTGGAGTTCTTTGGTCCAGGTGTACAACATTTACCACTAGCAGACCGT
    GCTACAATTGCAAACATGGCACCAGAGTATGGAGCAACTTGCGGATTCTTCCCAGTTGAT
    GATGAATCTCTTAAATATATGAAGTTAACTGGTAGATCAGACGAACATATCGCGCTAGTA
    AAAGAATATTTGAAACAAAACCATATGTTCTTTGATGTTGAGAAAGAAGATCCTAATTAT
    ACAGATGTTATCGAATTGGATTTATCAACAGTTGAAGCATCGCTTTCAGGACCAAAACGT
    CCTCAAGATTTAATTTTCTTAAGTGATATGAAATCATCATTTGAAAATTCTGTAACAGCT
    CCAGCAGGCAACCAAGGACACGGTTTAGATAAAAGTGAATTTGATAAGAAAGCTGAAATT
    AACTTTAAAGATGGATCAAAAGCTACAATGAAAACAGGTGATATTGCAATAGCAGCAATT
    ACATCATGTACAAATACATCTAACCCTTATGTAATGTTAGGTGCAGGTTTAGTTGCTAAA
    AAAGCAGTTGAAAAAGGCTTGAAAGTTCCTGAATACGTTAAAACTTCTCTAGCACCAGGA
    TCAAAAGTTGTTACCGGATATTTAAGAGATGCTGGCTTACAACCTTATTTAGATGATTTA
    GGCTTCAACTTGGTTGGTTATGGATGTACAACTTGTATCGGTAATTCAGGTCCTTTATTA
    CCAGAAATTGAAAAAGCGATTGCTGATGAGGACCTATTAGTGACATCTGTATTATCTGGT
    AACCGTAACTTTGAAGGTCGTATCCATCCTCTTGTTAAAGCCAATTACCTAGCTTCACCA
    CAGTTAGTTGTTGCTTATGCATTAGCTGGAACGGTTGATATTGATTTACAAAATGAACCT
    ATTGGTAAAGGTAATGACGGTGAAGATGTATATTTGAAAGATATTTGGCCATCAATTAAA
    GAAGTTTCAGATACCGTTGATAGTGTTGTAACACCTGAATTATTTATTGAAGAATATAAT
    AACGTATACAATAACAACGAATTATGGAATGAGATTGATGTAACTGATCAACCTCTATAT
    GACTTTGATCCTAATTCAACATACATTCAAAATCCATCATTCTTCCAAGGATTATCTAAA
    GAACCGGGTACGATTGTTCCATTAAATGGTTTACGTGTTATGGGTAAATTCGGTGATTCT
    GTGACAACTGACCACATCTCTCCAGCAGGTGCAATTGGTAAAGATACGCCAGCTGGTAAA
    TATTTACAAGATCATCAAGTGCCTATTCGTGAATTTAATTCATATGGTTCAAGACGTGGT
    AATCACGAAGTAATGGTTCGAGGTACGTTTGCTAATATACGTATTAAAAACCAATTAGCG
    CCAGGTACTGAAGGTGGTTTTACAACTTATTGGCCAACAAATGAAGTAATGCCTATCTTT
    GATGCTGCAATGAAATATAAAGAAGATGGTACAGGTTTAGTTGTATTAGCTGGTAACGAT
    TATGGTATGGGTTCATCTCGTGACTGGGCAGCAAAAGGTACAAACTTATTAGGTGTTAAA
    ACAGTTATTGCACAAAGTTATGAACGTATCCATCGTTCAAATTTAGTTATGATGGGTGTA
    TTACCATTAGAGTTTAAAAAAGGTGAATCAGCTGATTCTCTTGGTCTAGATGGTACAGAA
    GAAATTTCTGTTAATATTGATGAAAATGTTCAACCACATGACTACGTCAAAGTTACTGCT
    AAGAAGCAAGATGGTGATTTGGTAGAATTTGACGCTATGGTTCGTTTTGACTCACTTGTT
    GAAATGGATTACTATCGTCACGGTGGAATTTTACAAATGGTTTTAAGAAATAAATTAGCG
    CAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2706

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1385 [new locus tag: SACOL_RS07050 ]
  • symbol: AcnA
  • description: aconitate hydratase
  • length: 901
  • theoretical pI: 4.58662
  • theoretical MW: 98969
  • GRAVY: -0.276249

Function[edit source | edit]

  • reaction:
    EC 4.2.1.99?  ExPASy
    2-methylisocitrate dehydratase(2S,3R)-3-hydroxybutane-1,2,3-tricarboxylate = (Z)-but-2-ene-1,2,3-tricarboxylate + H2O
    EC 4.2.1.3?  ExPASy
    Aconitate hydrataseCitrate = isocitrate
  • TIGRFAM:
    MetabolismEnergy metabolismTCA cycleaconitate hydratase 1 (TIGR01341; EC 4.2.1.3; HMM-score: 1440.3)
    2-methylisocitrate dehydratase, Fe/S-dependent (TIGR02333; EC 4.2.1.99; HMM-score: 785.6)
    MetabolismEnergy metabolismTCA cycleaconitate hydratase, mitochondrial (TIGR01340; EC 4.2.1.3; HMM-score: 240.6)
    MetabolismEnergy metabolismTCA cycleputative aconitate hydratase (TIGR01342; EC 4.2.1.3; HMM-score: 239.1)
    homoaconitate hydratase family protein (TIGR01343; HMM-score: 118.3)
    3-isopropylmalate dehydratase, large subunit (TIGR02086; HMM-score: 113.8)
    MetabolismAmino acid biosynthesisPyruvate family3-isopropylmalate dehydratase, large subunit (TIGR02083; EC 4.2.1.33; HMM-score: 110.8)
    MetabolismAmino acid biosynthesisAspartate familyhomoaconitase (TIGR00139; EC 4.2.1.36; HMM-score: 97.8)
    MetabolismAmino acid biosynthesisPyruvate family3-isopropylmalate dehydratase, large subunit (TIGR00170; EC 4.2.1.33; HMM-score: 89.8)
    3-isopropylmalate dehydratase, small subunit (TIGR02087; HMM-score: 48.5)
    MetabolismAmino acid biosynthesisPyruvate family3-isopropylmalate dehydratase, small subunit (TIGR02084; EC 4.2.1.33; HMM-score: 37.5)
    MetabolismAmino acid biosynthesisPyruvate family3-isopropylmalate dehydratase, small subunit (TIGR00171; EC 4.2.1.33; HMM-score: 27.8)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismTCA Cycle Aconitate hydratase (EC 4.2.1.3) 
    One-carbon MetabolismSerine-glyoxylate cycle Aconitate hydratase (EC 4.2.1.3) 
    RespirationRespiration - no subcategoryBiogenesis of c-type cytochromes Aconitate hydratase (EC 4.2.1.3) 
  • PFAM:
    no clan definedAconitase; Aconitase family (aconitate hydratase) (PF00330; HMM-score: 588.2)
    Leu-IlvD (CL0364) Aconitase_C; Aconitase C-terminal domain (PF00694; HMM-score: 146.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: [4Fe-4S] cluster
  • effectors:
  • protein partners:
    SACOL1760(ackA)acetate kinase  [1] (data from MRSA252)
    SACOL0660(adhP)alcohol dehydrogenase  [1] (data from MRSA252)
    SACOL2218(adk)adenylate kinase  [1] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SACOL1758(ald2)alanine dehydrogenase  [1] (data from MRSA252)
    SACOL2656(arcB2)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SACOL0663(argS)arginyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1494(asnC)asparaginyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1215(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    SACOL1786(ccpA)catabolite control protein A  [1] (data from MRSA252)
    SACOL0833(clpP)ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [1] (data from MRSA252)
    SACOL1800(dat)D-alanine aminotransferase  [1] (data from MRSA252)
    SACOL2130(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SACOL0634(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SACOL0988(fabF)3-oxoacyl-ACP synthase  [1] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SACOL2091(fabZ)(3R)-hydroxymyristoyl-ACP dehydratase  [1] (data from MRSA252)
    SACOL2117(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [1] (data from MRSA252)
    SACOL1782(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SACOL1198(ftsA)cell division protein FtsA  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SACOL0877(gcvH)glycine cleavage system protein H  [1] (data from MRSA252)
    SACOL2151(glmM)phosphoglucosamine mutase  [1] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL1742(gltA)citrate synthase  [1] (data from MRSA252)
    SACOL0961(gluD)glutamate dehydrogenase  [1] (data from MRSA252)
    SACOL1622(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SACOL1665(greA)transcription elongation factor GreA  [1] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [1] (data from MRSA252)
    SACOL2017(groES)co-chaperonin GroES  [1] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    SACOL0554(hpt)hypoxanthine phosphoribosyltransferase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1206(ileS)isoleucyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL0600(ilvE)branched-chain amino acid aminotransferase  [1] (data from MRSA252)
    SACOL0240(ispD)2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [1] (data from MRSA252)
    SACOL1368(kataA)catalase  [1] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL2618(ldh2)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL0562(lysS)lysyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1054(menB)naphthoate synthase  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL2116(murAB)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SACOL1509(ndk)nucleoside diphosphate kinase  [1] (data from MRSA252)
    SACOL0746(norR)MarR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0792(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SACOL0793(nrdF)ribonucleotide-diphosphate reductase subunit beta  [1] (data from MRSA252)
    SACOL1285(nusA)transcription elongation factor NusA  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1005(pepF)oligoendopeptidase F  [1] (data from MRSA252)
    SACOL1746(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SACOL0839(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SACOL0841(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL1293(pnp)polynucleotide phosphorylase/polyadenylase  [1] (data from MRSA252)
    SACOL1982(ppaC)manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SACOL1092(ptsI)phosphoenolpyruvate-protein phosphotransferase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SACOL2221(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SACOL2120(rpoE)DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SACOL1516(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SACOL2056(rsbV)anti-anti-sigma factor RsbV  [1] (data from MRSA252)
    SACOL2055(rsbW)serine-protein kinase RsbW  [1] (data from MRSA252)
    SACOL0009(serS)seryl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1610(sodA2)superoxide dismutase  [1] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [1] (data from MRSA252)
    SACOL1262(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SACOL1831(tal)translaldolase  [1] (data from MRSA252)
    SACOL1729(thrS)threonyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1722(tig)trigger factor  [1] (data from MRSA252)
    SACOL1377(tkt)transketolase  [1] (data from MRSA252)
    SACOL1762(tpx)thiol peroxidase  [1] (data from MRSA252)
    SACOL1155(trxA)thioredoxin  [1] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SACOL0457hypothetical protein  [1] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SACOL05962-amino-3-ketobutyrate coenzyme A ligase  [1] (data from MRSA252)
    SACOL0688ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SACOL0815ribosomal subunit interface protein  [1] (data from MRSA252)
    SACOL0876hypothetical protein  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1020hypothetical protein  [1] (data from MRSA252)
    SACOL1427ABC transporter ATP-binding protein  [1] (data from MRSA252)
    SACOL1454  [1] (data from MRSA252)
    SACOL1457PTS system, IIA component  [1] (data from MRSA252)
    SACOL1593glycine dehydrogenase subunit 2  [1] (data from MRSA252)
    SACOL1801dipeptidase PepV  [1] (data from MRSA252)
    SACOL1952ferritins family protein  [1] (data from MRSA252)
    SACOL2131Dps family protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)
    SACOL2296glycerate dehydrogenase  [1] (data from MRSA252)
    SACOL2367alcohol dehydrogenase, zinc-containing  [1] (data from MRSA252)
    SACOL2535D-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL2561hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SACOL25691-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 11
    • Cmax: 0.109
    • Cmax_pos: 3
    • Smax: 0.211
    • Smax_pos: 1
    • Smean: 0.096
    • D: 0.103
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAANFKEQSKKHFDLNGQSYTYYDLKAVEEQGITKVSNLPYSIRVLLESLLRQEDDFVITDDHIKALSQFGKDGNEGEVPFKPSRVILQDFTGVPAVVDLASLRKAMDDVGGDITKINPEVPVDLVIDHSVQVDSYANPEALERNMKLEFERNYERYQFLNWATKAFDNYNAVPPATGIVHQVNLEYLASVVHVRDVDGEKTAFPDTLVGTDSHTTMINGIGVLGWGVGGIEAEAGMLGQPSYFPIPEVIGVRLVNSLPQGATATDLALRVTQELRKKGVVGKFVEFFGPGVQHLPLADRATIANMAPEYGATCGFFPVDDESLKYMKLTGRSDEHIALVKEYLKQNHMFFDVEKEDPNYTDVIELDLSTVEASLSGPKRPQDLIFLSDMKSSFENSVTAPAGNQGHGLDKSEFDKKAEINFKDGSKATMKTGDIAIAAITSCTNTSNPYVMLGAGLVAKKAVEKGLKVPEYVKTSLAPGSKVVTGYLRDAGLQPYLDDLGFNLVGYGCTTCIGNSGPLLPEIEKAIADEDLLVTSVLSGNRNFEGRIHPLVKANYLASPQLVVAYALAGTVDIDLQNEPIGKGNDGEDVYLKDIWPSIKEVSDTVDSVVTPELFIEEYNNVYNNNELWNEIDVTDQPLYDFDPNSTYIQNPSFFQGLSKEPGTIVPLNGLRVMGKFGDSVTTDHISPAGAIGKDTPAGKYLQDHQVPIREFNSYGSRRGNHEVMVRGTFANIRIKNQLAPGTEGGFTTYWPTNEVMPIFDAAMKYKEDGTGLVVLAGNDYGMGSSRDWAAKGTNLLGVKTVIAQSYERIHRSNLVMMGVLPLEFKKGESADSLGLDGTEEISVNIDENVQPHDYVKVTAKKQDGDLVEFDAMVRFDSLVEMDYYRHGGILQMVLRNKLAQ

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4] [5]
    quantitative data / protein copy number per cell: 5443 [6]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 1.121 1.122 1.123 1.124 1.125 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  6. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]