From AureoWiki
Jump to: navigation, search

NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1271 [new locus tag: SA_RS07205 ]
  • pan locus tag?: SAUPAN003892000
  • symbol: SA1271
  • pan gene symbol?: ilvA1
  • synonym:
  • product: threonine dehydratase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1271 [new locus tag: SA_RS07205 ]
  • symbol: SA1271
  • product: threonine dehydratase
  • replicon: chromosome
  • strand: -
  • coordinates: 1473100..1474140
  • length: 1041
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGACAACCAACACAGTTACATTACAAACAGCACATATTGTAAGTTTAGGAGATATCGAA
    GAAGCTAAAGCAAGCATTAAACCATTTATTCGTCGAACACCACTAATTAAATCTATGTAT
    TTAAGTCAAAATATCACTAAAGGTAACGTATATTTAAAACTTGAAAATATGCAGTTTACA
    GGTTCATTTAAATTTAGAGGTGCTAGCAATAAAATTAATCATTTGTCAGATGAACAAAAA
    GCTAAAGGTATTATTGGCGCATCAGCCGGAAATCATGCACAAGGTGTAGCTTTGACAGCA
    AAACTATTAGGTATTGATGCAACGATTGTGATGCCAGAAACAGCACCAATTGCTAAACAG
    AATGCTACCAAAGGATATGGTGCAAAAGTCATTTTAAAAGGTAAAAACTTTAATGAAACT
    AGACTTTATATGGAAGAATTAGCGAAAGAAAATGGTATGACAATTGTTCATCCATATGAT
    GATAAGTTTGTCATGGCTGGTCAAGGAACAATAGGATTAGAAATTTTAGATGATATATGG
    AATGTTAATACGGTCATTGTTCCAGTTGGTGGAGGTGGCCTAATTGCAGGTATTGCCACC
    GCTTTAAAATCATTCAACCCATCAATTCATATAATCGGCGTTCAAGCTGAAAATGTGCAT
    GGCATGGCAGAGTCATTCTATAAGAGAGCTTTAACTGAACATCGTGAAGATAGCACAATT
    GCAGATGGTTGTGATGTAAAAGTACCAGGTGAAAAAACATACGAAGTAGTAAAACATTTA
    GTAGATGAATTTATTCTTGTATCAGAAGAGGAAATAGAACATGCAATGCAAGATTTAATG
    CAACGTGCCAAAATCATTACAGAAGGTGCAGGAGCTTTACCTACAGCAGCTATTTTAAGT
    GGGAAAATTGATAAAAAATGGCTAGAGGGTAAAAATGTCGTTGCATTAGTTTCAGGAGGA
    AACGTTGACTTAACTAGAGTTTCTGGTGTCATTGAACATGGCTTAAATATCGCGGATACA
    AGTAAGGGTGTGGTAGGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1041

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1271 [new locus tag: SA_RS07205 ]
  • symbol: SA1271
  • description: threonine dehydratase
  • length: 346
  • theoretical pI: 6.86975
  • theoretical MW: 37146.5
  • GRAVY: -0.0372832

Function[edit source | edit]

  • reaction:
    EC 4.3.1.19?  ExPASy
    Threonine ammonia-lyaseL-threonine = 2-oxobutanoate + NH3
  • TIGRFAM:
    MetabolismAmino acid biosynthesisPyruvate familythreonine ammonia-lyase (TIGR01127; EC 4.3.1.19; HMM-score: 400.1)
    and 16 more
    MetabolismAmino acid biosynthesisPyruvate familythreonine ammonia-lyase, biosynthetic (TIGR01124; EC 4.3.1.19; HMM-score: 298.3)
    ectoine utilization protein EutB (TIGR02991; HMM-score: 267.4)
    MetabolismAmino acid biosynthesisPyruvate familythreonine dehydratase (TIGR02079; EC 4.3.1.19; HMM-score: 263.5)
    MetabolismAmino acid biosynthesisSerine familycysteine synthase (TIGR01136; EC 2.5.1.47; HMM-score: 89.2)
    MetabolismAmino acid biosynthesisAspartate familythreonine synthase (TIGR00260; EC 4.2.3.1; HMM-score: 81.7)
    MetabolismAmino acid biosynthesisSerine familycysteine synthase A (TIGR01139; EC 2.5.1.47; HMM-score: 77.9)
    MetabolismAmino acid biosynthesisSerine familycysteine synthase B (TIGR01138; EC 2.5.1.47; HMM-score: 68.2)
    Cellular processesCellular processesBiosynthesis of natural products2,3-diaminopropionate biosynthesis protein SbnA (TIGR03945; HMM-score: 66.3)
    MetabolismAmino acid biosynthesisSerine familycystathionine beta-synthase (TIGR01137; EC 4.2.1.22; HMM-score: 55.3)
    diaminopropionate ammonia-lyase (TIGR03528; EC 4.3.1.15; HMM-score: 49.7)
    MetabolismEnergy metabolismOtherdiaminopropionate ammonia-lyase family (TIGR01747; EC 4.3.1.15; HMM-score: 42.4)
    MetabolismAmino acid biosynthesisAromatic amino acid familytryptophan synthase, beta subunit (TIGR00263; EC 4.2.1.20; HMM-score: 30.7)
    pyridoxal phosphate-dependent enzymes, D-cysteine desulfhydrase family (TIGR01275; HMM-score: 28.4)
    Unknown functionEnzymes of unknown specificitypyridoxal-phosphate dependent TrpB-like enzyme (TIGR01415; HMM-score: 23.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteate synthase (TIGR03844; EC 2.5.1.76; HMM-score: 17.3)
    MetabolismEnergy metabolismMethanogenesiscysteate synthase (TIGR03844; EC 2.5.1.76; HMM-score: 17.3)
  • TheSEED:  
    Amino Acids and DerivativesAlanine, serine, and glycineGlycine and Serine Utilization Threonine dehydratase, catabolic (EC 4.3.1.19) 
    and 3 more
    Branched-chain amino acidsBranched-Chain Amino Acid Biosynthesis Threonine dehydratase, catabolic (EC 4.3.1.19) 
    Lysine, threonine, methionine, and cysteineThreonine degradation Threonine dehydratase, catabolic (EC 4.3.1.19) 
    Branched-Chain Amino Acid Biosynthesis L-serine dehydratase, (PLP)-dependent (EC 4.3.1.17) 
  • PFAM:
    no clan definedPALP; Pyridoxal-phosphate dependent enzyme (PF00291; HMM-score: 272.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:
    SA0366(ahpC)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [1] (data from MRSA252)
    SA1608(metK)S-adenosylmethionine synthetase  [1] (data from MRSA252)
    SA2334(mvaS)3-hydroxy-3-methylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA0627hypothetical protein  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.231
    • Ymax_pos: 25
    • Cmax: 0.313
    • Cmax_pos: 25
    • Smax: 0.213
    • Smax_pos: 21
    • Smean: 0.156
    • D: 0.202
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTTNTVTLQTAHIVSLGDIEEAKASIKPFIRRTPLIKSMYLSQNITKGNVYLKLENMQFTGSFKFRGASNKINHLSDEQKAKGIIGASAGNHAQGVALTAKLLGIDATIVMPETAPIAKQNATKGYGAKVILKGKNFNETRLYMEELAKENGMTIVHPYDDKFVMAGQGTIGLEILDDIWNVNTVIVPVGGGGLIAGIATALKSFNPSIHIIGVQAENVHGMAESFYKRALTEHREDSTIADGCDVKVPGEKTYEVVKHLVDEFILVSEEEIEHAMQDLMQRAKIITEGAGALPTAAILSGKIDKKWLEGKNVVALVSGGNVDLTRVSGVIEHGLNIADTSKGVVG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CodY regulon
    CodY(TF)important in Amino acid metabolismRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]