From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS08040 [old locus tag: NWMN_1424 ]
  • pan locus tag?: SAUPAN004073000
  • symbol: NWMN_RS08040
  • pan gene symbol?: lpdA
  • synonym:
  • product: dihydrolipoyl dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS08040 [old locus tag: NWMN_1424 ]
  • symbol: NWMN_RS08040
  • product: dihydrolipoyl dehydrogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 1594714..1596135
  • length: 1422
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1594714..1596135) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGTCAGAGAAACAATATGATTTAGTCGTTCTCGGTGGAGGTACTGCAGGATATGTTGCT
    GCGATACGTGCGTCTCAATTAGGTAAAAAAGTGGCAATAGTAGAACGACAACTATTAGGA
    GGTACTTGTCTCCATAAAGGTTGTATTCCTACTAAATCGCTGCTTAAATCTGCTGAAGTA
    TTTCAAACAGTAAAACAGGCAGCAATGTTTGGCGTTGATGTCAAAGATGCTAATGTTAAT
    TTTGAAAATATGTTGGCACGAAAAGAAGACATTATTAATCAAATGTATCAAGGTGTAAAG
    CATTTAATGCAACACAATCACATTGACATTTATAATGGCACGGGACGTATTCTAGGTACA
    TCTATATTTTCACCTCAAAGTGGCACAATTTCTGTCGAATATGAAGATGGTGAATCAGAC
    TTATTACCCAACCAATTTGTATTAATTGCAACTGGTTCTTCGCCTGCAGAGTTGCCATTC
    TTATCATTTGATCATGATAAAATTTTATCTAGCGATGATATATTATCATTAAAGACGTTA
    CCATCAAGTATTGGTATTATTGGTGGTGGTGTTATCGGAATGGAATTTGCATCATTGATG
    ATAGATTTAGGTGTTGACGTAACAGTTATAGAAGCAGGTGAAAGAATTTTACCAACTGAA
    AGTAAACAAGCTTCACAACTATTAAAAAAATCATTGTCAGCACGTGGTGTTAAATTCTAT
    GAGGGAATAAAACTTTCTGAAAATGATATAAATGTTAACGAAGATGGTGTTACGTTTGAA
    ATTTCCTCAGACATAATTAAAGTAGATAAAGTGTTGCTATCGATTGGTAGAAAACCTAAC
    ACATCAGATATTGGTTTAAACAACACTAAAATAAAACTTTCAACATCAGGACATATTTTA
    ACGAACGAATTTCAACAAACTGAAGATAAACATATTTATGCAGCTGGTGATTGTATAGGA
    AAATTACAATTGGCACATGTTGGATCAAAAGAAGGTGTTGTGGCTGTTGATCATATGTTT
    GAGGGGAACCCAATCCCAGTAAACTATAACATGATGCCTAAGTGTATTTATTCACAACCT
    GAAATTGCTTCTATCGGTTTAAACATTGAACAAGCAAAGGCAGAGGGAATGAAAGTTAAA
    AGTTTTAAAGTACCATTTAAAGCAATTGGTAAAGCAGTGATTGATAGCCATGACACAAAC
    GAAGGGTATAGCGAAATGGTGATTGATCAATCAACTGAAGAAATTGTGGGTATTAATATG
    ATTGGTCCACATGTAACAGAATTGATTAATGAGGCATCACTGTTACAGTTCATGAATGGC
    TCGGCATTAGAATTAGGACTAACAACACACGCACATCCTTCCATCTCTGAAGTGTTGATG
    GAATTAGGATTGAAAGCAGAAAGTAGAGCTATTCACGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1422

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS08040 [old locus tag: NWMN_1424 ]
  • symbol: NWMN_RS08040
  • description: dihydrolipoyl dehydrogenase
  • length: 473
  • theoretical pI: 5.20012
  • theoretical MW: 51111.3
  • GRAVY: -0.015222

Function[edit source | edit]

  • reaction:
    EC 1.8.1.4?  ExPASy
    Dihydrolipoyl dehydrogenaseProtein N6-(dihydrolipoyl)lysine + NAD+ = protein N6-(lipoyl)lysine + NADH
  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 501.1)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 313.4)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 259.8)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 236.3)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 200.1)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 178.6)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 154.2)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 72.8)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 65.5)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 50.8)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 50.7)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 37.9)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 37.9)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 34)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 33.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 30.6)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 30.2)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 27.7)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 25.5)
    MetabolismEnergy metabolismAmino acids and aminesalanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 25)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 25)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 23.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 22.5)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 20.2)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 19.1)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 19)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 18.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 17.3)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 17.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 16.8)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 15.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 15.2)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 14.6)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 14.2)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 13.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 12.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 12.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin 3B synthase CobZ (TIGR02485; HMM-score: 11.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 11.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesL-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 10.7)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 10)
    MetabolismEnergy metabolismAnaerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 10)
    MetabolismEnergy metabolismAerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 10)
    lycopene cyclase family protein (TIGR01790; HMM-score: 8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 6.7)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 200.5)
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 101.2)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 70.2)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 35.1)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 33.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 33)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 32.7)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 31.7)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 28.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 25)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 24.6)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 24.3)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 19.4)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 17.6)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 17)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 16.4)
    Thi4; Thi4 family (PF01946; HMM-score: 14.9)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 13.1)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:
    NWMN_RS05380pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    NWMN_RS080252-oxoglutarate dehydrogenase E2  [1] (data from MRSA252)
    NWMN_RS080352-oxoisovalerate dehydrogenase subunit alpha  [1] (data from MRSA252)
    NWMN_RS08905isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)
    NWMN_RS1234030S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.141
    • Ymax_pos: 33
    • Cmax: 0.122
    • Cmax_pos: 33
    • Smax: 0.27
    • Smax_pos: 31
    • Smean: 0.116
    • D: 0.131
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447214279 NCBI
  • RefSeq: WP_001291535 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSEKQYDLVVLGGGTAGYVAAIRASQLGKKVAIVERQLLGGTCLHKGCIPTKSLLKSAEVFQTVKQAAMFGVDVKDANVNFENMLARKEDIINQMYQGVKHLMQHNHIDIYNGTGRILGTSIFSPQSGTISVEYEDGESDLLPNQFVLIATGSSPAELPFLSFDHDKILSSDDILSLKTLPSSIGIIGGGVIGMEFASLMIDLGVDVTVIEAGERILPTESKQASQLLKKSLSARGVKFYEGIKLSENDINVNEDGVTFEISSDIIKVDKVLLSIGRKPNTSDIGLNNTKIKLSTSGHILTNEFQQTEDKHIYAAGDCIGKLQLAHVGSKEGVVAVDHMFEGNPIPVNYNMMPKCIYSQPEIASIGLNIEQAKAEGMKVKSFKVPFKAIGKAVIDSHDTNEGYSEMVIDQSTEEIVGINMIGPHVTELINEASLLQFMNGSALELGLTTHAHPSISEVLMELGLKAESRAIHV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS08040 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5

Relevant publications[edit source | edit]