From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS08695 [old locus tag: NWMN_1551 ]
  • pan locus tag?: SAUPAN004255000
  • symbol: NWMN_RS08695
  • pan gene symbol?: mreC
  • synonym:
  • product: rod shape-determining protein MreC

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS08695 [old locus tag: NWMN_1551 ]
  • symbol: NWMN_RS08695
  • product: rod shape-determining protein MreC
  • replicon: chromosome
  • strand: -
  • coordinates: 1716997..1717839
  • length: 843
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1716997..1717839) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    GTGCTTAAGTTTTTTAAAAATAACAAATTAATTGTTGTTTTATGTGCAATTATCGTTTTT
    ATTGCATTAATTGGGCTGTCCATACGTTCACAATCTCAATCACCTCCTGAACAATATATA
    GGTGATTCTGTGTCTTTTGGACAACGAGTTGTGAGTTATCCAGTTAATTTTGTTGCTGGT
    ACGATTGGGGACTTTTTTAAAAAAGGAGATTCTAAAGAATCTAAAAATAAGATTAGCCAG
    TTAGAATCTAAGAACCAACAATTAGAAGCGGAAAATGAAAAATTAAAAAAAGAGCTTGAT
    TTAAAAGATATTTCAAAATTTGATCCTATTTCTACTACGGTTTTGGCAAGAAATCCGGAT
    CAGTGGATGAATACAATTGTAATTGATAAGGGATCTAAATCAGGTATAACTTCAAATATG
    GCTGTGATGACATCACAAGGTTTTGTTGGAAGAGTTACTAAAGTTAATAAATTTTCTTCA
    CAAGTTGATTTAATCTCAACTAATACACGTGCGGGTAAATTATCTGTAAATATACAACAC
    GGTTCTAAAAATATATTTGGTTTAATTGATCGTTATGATGAAAAGAACTCAGAACTTGTA
    ATTAGTGACATTAATAATAGAGATAATATCTCAAAAGGTGATAAAGTCGTTACAAGTGGA
    TTAGCTGATCAACTACCAAGTAATTTATATATAGGAGAAGTGACTAAGGTTCAAAATGAT
    CAATACGGCTTAGCTAAAGAAGTTAGGGTTAAGACTGGTGCGGACTTAACAGATTTGAGT
    CATGTTTATGTTGCAAAAAGAGATCCTAAAACAATTCCTGATGATGAAAGCAGGGATAAA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    843

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS08695 [old locus tag: NWMN_1551 ]
  • symbol: NWMN_RS08695
  • description: rod shape-determining protein MreC
  • length: 280
  • theoretical pI: 9.59859
  • theoretical MW: 31010
  • GRAVY: -0.398929

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanrod shape-determining protein MreC (TIGR00219; HMM-score: 147)
    Genetic information processingMobile and extrachromosomal element functionsPlasmid functionsintegrating conjugative element protein, PFL_4705 family (TIGR03752; HMM-score: 18.1)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingpreprotein translocase, YajC subunit (TIGR00739; HMM-score: 15)
    integrating conjugative element protein, PFL_4669 family (TIGR03761; HMM-score: 12.1)
    Cellular processesCellular processesCell divisioncell division protein FtsL (TIGR02209; HMM-score: 4.9)
  • TheSEED:
  • PFAM:
    no clan definedMreC; rod shape-determining protein MreC (PF04085; HMM-score: 135.4)
    YajC; Preprotein translocase subunit (PF02699; HMM-score: 22.5)
    TSC22; TSC-22/dip/bun family (PF01166; HMM-score: 18.7)
    FtsL (CL0225) DivIC; Septum formation initiator (PF04977; HMM-score: 17.4)
    no clan definedYabB; Initiation control protein YabA (PF06156; HMM-score: 16.6)
    IncA; IncA protein (PF04156; HMM-score: 15.4)
    OppC_N; N-terminal TM domain of oligopeptide transport permease C (PF12911; HMM-score: 15.2)
    DUF1845; Domain of unknown function (DUF1845) (PF08900; HMM-score: 15.1)
    bZIP (CL0018) bZIP_1; bZIP transcription factor (PF00170; HMM-score: 15)
    no clan definedKinetocho_Slk19; Central kinetochore-associated (PF12709; HMM-score: 14.7)
    bZIP (CL0018) bZIP_2; Basic region leucine zipper (PF07716; HMM-score: 14.5)
    no clan definedSwi5; Swi5 (PF07061; HMM-score: 12.8)
    Shugoshin_N; Shugoshin N-terminal coiled-coil region (PF07558; HMM-score: 7.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.373
    • Ymax_pos: 33
    • Cmax: 0.221
    • Cmax_pos: 33
    • Smax: 0.77
    • Smax_pos: 27
    • Smean: 0.551
    • D: 0.442
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446833785 NCBI
  • RefSeq: WP_000911041 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MLKFFKNNKLIVVLCAIIVFIALIGLSIRSQSQSPPEQYIGDSVSFGQRVVSYPVNFVAGTIGDFFKKGDSKESKNKISQLESKNQQLEAENEKLKKELDLKDISKFDPISTTVLARNPDQWMNTIVIDKGSKSGITSNMAVMTSQGFVGRVTKVNKFSSQVDLISTNTRAGKLSVNIQHGSKNIFGLIDRYDEKNSELVISDINNRDNISKGDKVVTSGLADQLPSNLYIGEVTKVQNDQYGLAKEVRVKTGADLTDLSHVYVAKRDPKTIPDDESRDK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS08695 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]