From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS09145 [old locus tag: NWMN_1629 ]
  • pan locus tag?: SAUPAN004400000
  • symbol: NWMN_RS09145
  • pan gene symbol?: ccpA
  • synonym:
  • product: catabolite control protein A

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS09145 [old locus tag: NWMN_1629 ]
  • symbol: NWMN_RS09145
  • product: catabolite control protein A
  • replicon: chromosome
  • strand: -
  • coordinates: 1813146..1814135
  • length: 990
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1813146..1814135) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGACAGTTACTATATATGATGTAGCAAGAGAAGCGCGTGTCTCTATGGCCACAGTGTCG
    CGTGTTGTTAATGGGAACCAAAATGTTAAAGCAGAAACTAAAAATAAAGTTAACGAAGTC
    ATTAAGCGTTTGAATTATCGTCCAAATGCTGTTGCTAGAGGTTTAGCTAGTAAAAAGACA
    ACAACAGTAGGTGTGATCATTCCAGATATATCTAATATCTATTATTCACAACTTGCTCGT
    GGACTTGAAGATATTGCAACAATGTATAAATATCACTCAATTATTTCAAATTCAGATAAC
    GATCCTGAAAAGGAAAAAGAAATTTTTAATAACTTATTAAGTAAACAGGTTGATGGTATT
    ATTTTCCTTGGTGGTACAATTACTGAAGAAATGAAAGAATTGATAAATCAATCATCTGTA
    CCTGTAGTAGTATCAGGAACAAATGGTAAGGATGCACATATAGCATCAGTTAATATTGAT
    TTTACTGAAGCTGCGAAAGAAATTACGGGAGAATTAATTGAAAAAGGCGCTAAATCATTT
    GCTTTAGTAGGTGGAGAACATTCTAAAAAAGCTCAAGAAGATGTTTTAGAAGGTTTAACT
    GAAGTGTTAAATAAAAATGGCCTTCAATTAGGTGATACATTGAATTGTTCTGGTGCTGAA
    AGTTATAAAGAAGGCGTAAAAGCTTTTGCCAAAATGAAAGGCAATTTGCCAGATGCCATT
    TTATGTATCAGCGACGAAGAAGCAATTGGTATTATGCATAGTGCAATGGATGCTGGTATT
    AAAGTTCCAGAGGAATTACAAATTATTAGTTTCAATAATACACGATTAGTTGAGATGGTT
    AGACCACAACTTTCTAGTGTTATTCAACCATTATATGATATCGGTGCAGTAGGGATGCGC
    TTATTAACAAAATATATGAACGATGAAAAGATAGAAGAACCAAATGTAGTTTTACCTCAC
    AGAATTGAATACCGAGGAACTACAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    990

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS09145 [old locus tag: NWMN_1629 ]
  • symbol: NWMN_RS09145
  • description: catabolite control protein A
  • length: 329
  • theoretical pI: 5.50763
  • theoretical MW: 36060
  • GRAVY: -0.229787

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionscatabolite control protein A (TIGR01481; HMM-score: 570.3)
    Signal transductionRegulatory functionsDNA interactionsD-fructose-responsive transcription factor (TIGR02417; HMM-score: 159)
    Signal transductionRegulatory functionsDNA interactionstrehalose operon repressor (TIGR02405; HMM-score: 107.1)
    Genetic information processingMobile and extrachromosomal element functionsOtheraddiction module antidote protein, HigA family (TIGR02607; HMM-score: 18.6)
    Signal transductionRegulatory functionsDNA interactionsaddiction module antidote protein, HigA family (TIGR02607; HMM-score: 18.6)
    Signal transductionRegulatory functionsProtein interactionsaddiction module antidote protein, HigA family (TIGR02607; HMM-score: 18.6)
  • TheSEED:
  • PFAM:
    Periplas_BP (CL0144) Peripla_BP_3; Periplasmic binding protein-like domain (PF13377; HMM-score: 105.4)
    Peripla_BP_4; Periplasmic binding protein domain (PF13407; HMM-score: 74.7)
    Peripla_BP_1; Periplasmic binding proteins and sugar binding domain of LacI family (PF00532; HMM-score: 71.1)
    HTH (CL0123) LacI; Bacterial regulatory proteins, lacI family (PF00356; HMM-score: 67.1)
    no clan definedATP-synt_F; ATP synthase (F/14-kDa) subunit (PF01990; HMM-score: 16.2)
    4Fe-4S (CL0344) Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 14.6)
    MurF-HprK_N (CL0365) Hpr_kinase_N; HPr Serine kinase N terminus (PF02603; HMM-score: 14.5)
    no clan definedDUF327; Protein of unknown function (DUF327) (PF03885; HMM-score: 13.9)
    HTH (CL0123) HTH_3; Helix-turn-helix (PF01381; HMM-score: 12.9)
    HTH_31; Helix-turn-helix domain (PF13560; HMM-score: 12.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: Signal peptide length 32 aa
    • Ymax: 0.542
    • Ymax_pos: 32
    • Cmax: 0.674
    • Cmax_pos: 32
    • Smax: 0.69
    • Smax_pos: 29
    • Smean: 0.354
    • D: 0.469
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446141211 NCBI
  • RefSeq: WP_000219066 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTVTIYDVAREARVSMATVSRVVNGNQNVKAETKNKVNEVIKRLNYRPNAVARGLASKKTTTVGVIIPDISNIYYSQLARGLEDIATMYKYHSIISNSDNDPEKEKEIFNNLLSKQVDGIIFLGGTITEEMKELINQSSVPVVVSGTNGKDAHIASVNIDFTEAAKEITGELIEKGAKSFALVGGEHSKKAQEDVLEGLTEVLNKNGLQLGDTLNCSGAESYKEGVKAFAKMKGNLPDAILCISDEEAIGIMHSAMDAGIKVPEELQIISFNNTRLVEMVRPQLSSVIQPLYDIGAVGMRLLTKYMNDEKIEEPNVVLPHRIEYRGTTK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS09145 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]