From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS13085 [old locus tag: NWMN_2274 ]
  • pan locus tag?: SAUPAN005890000
  • symbol: NWMN_RS13085
  • pan gene symbol?: iruO
  • synonym:
  • product: ferredoxin--NADP(+) reductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS13085 [old locus tag: NWMN_2274 ]
  • symbol: NWMN_RS13085
  • product: ferredoxin--NADP(+) reductase
  • replicon: chromosome
  • strand: -
  • coordinates: 2497724..2498758
  • length: 1035
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2497724..2498758) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGAAAGATGTTACAATCATTGGTGGCGGTCCGTCTGGTTTGTATGCAAGCTTTTATGCT
    GGATTGCGAGATATGTCTGTAAGATTGATAGATGTTCAATCTGAATTAGGGGGTAAGATG
    AGAATTTACCCTGAAAAAATTATTTGGGATATTGGCGGCATTGCGCCAAAACCTTGTCAT
    GAAATTTTAAAAGATACAATTAAGCAAGGATTATATTTTAAACCGGAAGTTCATTTGAAT
    GAACGTGTGGTAGATATTAGGAAAAAGGCAGAACGTCATTTCGAAGTTGAAACAGAAGCG
    GGAGAAATATATACATCGAAAGCAGTTATCATTGCAATTGGTGCGGGTATTATTAATCCA
    AAACAATTAGATGTTAAAGGTGTAGAGAGATATCAATTAACTAATTTACATTATGTTGTA
    CAAAGTTACAGACGTTTCAAAGATAAAGATGTATTAATATCAGGTGGAGGAAATACAGCA
    TTAGATTGGGCGCATGATATTGCCAAGATTGCTAAAAGCGTGACAGTTGTTTATCGAAAA
    GAAGATGTAAGTGGTCATGAAGCGATGAAAACGTTGGTGACAGATTTAAATGTGAAACTA
    TGCCCAAAAACACGTATTAAATACTTGGTCGGCAATGATGATGAAACGCATATAAGTGAA
    GTTGTTTTGGAACATGTTGAAAGTGGCGATAGGCATACAGTTAAATTTGACGATGTCATT
    ATTAGTCATGGGTTTGATCGTTGTAATACATTATTGAGTGAAACATCTTCAAAGCTAGAT
    ATGCATGATGATTGTCGTGTTAAAGGATTTGGTAATACGACAACTAGTATACCTGGTATC
    TATGCGTGTGGAGATATTGTTTATCATGATGCAAAATCACATCTAATTGCAAGTGCATTT
    AGTGATGGTGCAAATGCAGCGAACCTTGCTAAAACATATATCCAACCAGATGCGAATGCA
    GAGGGTTATGTTTCAAGTCATCATGAAGTGTTTAAAGAAGCGAATAAGACTATTGTAAAT
    AAACATTTATACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1035

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS13085 [old locus tag: NWMN_2274 ]
  • symbol: NWMN_RS13085
  • description: ferredoxin--NADP(+) reductase
  • length: 344
  • theoretical pI: 6.95916
  • theoretical MW: 38229.3
  • GRAVY: -0.27936

Function[edit source | edit]

  • reaction:
    EC 1.18.1.2?  ExPASy
    Ferredoxin--NADP+ reductase2 reduced ferredoxin + NADP+ + H+ = 2 oxidized ferredoxin + NADPH
  • TIGRFAM:
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 130)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 92.5)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 92.5)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 86.7)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 76.3)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 55.4)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 46.4)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 40.8)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 40.8)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 40.2)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 36.3)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 35)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 34.5)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 32.4)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 30.9)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 30.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 28)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 27.7)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 27.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 24.5)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 23.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 23)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 19.5)
    lycopene cyclase family protein (TIGR01790; HMM-score: 18.2)
    flavin-dependent oxidoreductase, MSMEG_0569 family (TIGR04046; HMM-score: 17.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 14.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprotoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 13.1)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 11.5)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 106.9)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 83.9)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 48)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 42.3)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 30.7)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 27.5)
    Thi4; Thi4 family (PF01946; HMM-score: 24.3)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 21.9)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 21.7)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 21.5)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 21.2)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 20.7)
    Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 19.3)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 16.7)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 15.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.093
    • Ymax_pos: 35
    • Cmax: 0.114
    • Cmax_pos: 20
    • Smax: 0.107
    • Smax_pos: 69
    • Smean: 0.061
    • D: 0.08
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446578625 NCBI
  • RefSeq: WP_000655971 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKDVTIIGGGPSGLYASFYAGLRDMSVRLIDVQSELGGKMRIYPEKIIWDIGGIAPKPCHEILKDTIKQGLYFKPEVHLNERVVDIRKKAERHFEVETEAGEIYTSKAVIIAIGAGIINPKQLDVKGVERYQLTNLHYVVQSYRRFKDKDVLISGGGNTALDWAHDIAKIAKSVTVVYRKEDVSGHEAMKTLVTDLNVKLCPKTRIKYLVGNDDETHISEVVLEHVESGDRHTVKFDDVIISHGFDRCNTLLSETSSKLDMHDDCRVKGFGNTTTSIPGIYACGDIVYHDAKSHLIASAFSDGANAANLAKTYIQPDANAEGYVSSHHEVFKEANKTIVNKHLY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS13085 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]