From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS14725 [old locus tag: NWMN_2566 ]
  • pan locus tag?: SAUPAN006412000
  • symbol: NWMN_RS14725
  • pan gene symbol?: icaD
  • synonym:
  • product: poly-beta-1,6-N-acetyl-D-glucosamine synthesis protein IcaD

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS14725 [old locus tag: NWMN_2566 ]
  • symbol: NWMN_RS14725
  • product: poly-beta-1,6-N-acetyl-D-glucosamine synthesis protein IcaD
  • replicon: chromosome
  • strand: +
  • coordinates: 2833969..2834274
  • length: 306
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2833969..2834274) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
    GAAACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
    GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
    TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
    ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
    TCGTGA
    60
    120
    180
    240
    300
    306

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS14725 [old locus tag: NWMN_2566 ]
  • symbol: NWMN_RS14725
  • description: poly-beta-1,6-N-acetyl-D-glucosamine synthesis protein IcaD
  • length: 101
  • theoretical pI: 5.82065
  • theoretical MW: 11782.9
  • GRAVY: 0.670297

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesintracellular adhesion protein D (TIGR03932; HMM-score: 132.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesoligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)
    integral membrane protein (TIGR04561; HMM-score: 5)
  • TheSEED:
  • PFAM:
    APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.2)
    Aa_trans; Transmembrane amino acid transporter protein (PF01490; HMM-score: 15.8)
    no clan definedDUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 14.1)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 9.3)
    no clan definedDUF3671; Protein of unknown function (PF12420; HMM-score: 8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.17
    • Ymax_pos: 11
    • Cmax: 0.113
    • Cmax_pos: 26
    • Smax: 0.381
    • Smax_pos: 3
    • Smean: 0.288
    • D: 0.216
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 446162725 NCBI
  • RefSeq: WP_000240580 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS14725 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]