From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2566 [new locus tag: NWMN_RS14725 ]
  • pan locus tag?: SAUPAN006412000
  • symbol: icaD
  • pan gene symbol?: icaD
  • synonym:
  • product: intercellular adhesion protein IcaD

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2566 [new locus tag: NWMN_RS14725 ]
  • symbol: icaD
  • product: intercellular adhesion protein IcaD
  • replicon: chromosome
  • strand: +
  • coordinates: 2833969..2834274
  • length: 306
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
    GAAACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
    GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
    TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
    ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
    TCGTGA
    60
    120
    180
    240
    300
    306

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2566 [new locus tag: NWMN_RS14725 ]
  • symbol: IcaD
  • description: intercellular adhesion protein IcaD
  • length: 101
  • theoretical pI: 5.82065
  • theoretical MW: 11782.9
  • GRAVY: 0.670297

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesintracellular adhesion protein D (TIGR03932; HMM-score: 132.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesoligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)
    integral membrane protein (TIGR04561; HMM-score: 5)
  • TheSEED:  
    Regulation and Cell signalingQuorum sensing and biofilm formationBiofilm formation in Staphylococcus Polysaccharide intercellular adhesin (PIA) biosynthesis protein IcaD 
  • PFAM:
    APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.2)
    Aa_trans; Transmembrane amino acid transporter protein (PF01490; HMM-score: 15.8)
    no clan definedDUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 14.1)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 9.3)
    no clan definedDUF3671; Protein of unknown function (PF12420; HMM-score: 8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.17
    • Ymax_pos: 11
    • Cmax: 0.113
    • Cmax_pos: 26
    • Smax: 0.381
    • Smax_pos: 3
    • Smean: 0.288
    • D: 0.216
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: CodY, IcaR
    CodY (TF) important in Amino acid metabolism  RegPrecise    transcription unit transferred from N315 data RegPrecise
    IcaR (TF) important in Intercellular adhesion  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]