From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0229 [new locus tag: SA_RS01340 ]
  • pan locus tag?: SAUPAN001102000
  • symbol: SA0229
  • pan gene symbol?: opp-5A
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0229 [new locus tag: SA_RS01340 ]
  • symbol: SA0229
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 277228..278703
  • length: 1476
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGAAGTTTAAAAGACTAGCAACTATATTTTCAGCAGTATTAGTGTTATCAGGATGTGGC
    TCAATGCATTCATCTGGCAAAGACTTAAATATTTCGTTACCGTTAAAAACAAAGTCTATT
    GCACCTTATGAAACAGATGTACCAGTTAAGATTGGTGCTGCAGAATCATTATTTAAAACA
    AATGATCAAGGAAAAATAGAAAAAGCATTAGTGAAATCGTATCATCAACCAAATGATACA
    ACGTTAGATATAGAATTAAAAGATAATATTAAATTTCAAAACGGTCAAAAATTGACTGCA
    GAAAAAGTGAAATCTAGCCTTGAAAATAGCATGAAAAAAAGCGACTTGGTCAAATATTCA
    TTACCAATATCATCAATTACCGCTAAAGGTCAAAAACTGACAATTAAAACCAACTCCGCT
    TACCCTGAACTTGTATCTGAATTAGCTAATCCTTTTATGGCAATTTATTATACAGATGCT
    AAATCAGATGTTAATCAAACTCCTGTTGGTACAGGCCCTTACCAAATAAAAGATTATAAG
    CAATCTCGAAAAATATCATTGTCGAATTTTAAGGACTATTGGCAAGGTAAACCGAAACTT
    GATCATATTACTGTGACGTACCAAGAAGACGGCAATAATCGCGTCAGAAATTTAGAATCT
    CAAAAAGATGATTTAATAACTGATGTCCCAGTTAATAAAGTTCATGACATAGAAAATAAT
    CAAAATTTAAAAGTGTCAAAAGAATCTGGATTTAGAACTTCTTTACTTATGTATAATCAT
    ACTAATAAAAAAATGACTAAATCCGTTCGTGAAGCATTAGATCATATCATTGATAGACAA
    GGTATTGCAGATCATATTTATCAAGGTTATGCGAAACCTGCAACGAGTCCATTTAATGAT
    AAAATTCCATATATTAAAGAACCTAAGTTAACCAAACAAAATATCGAACAAGCAAAAACG
    TTATTAGCTAAAGATGGTTATACAAAAGAACACCCTTTAAAAATTAAGTTAATTACGTAT
    GACGGTCGTCCAGAGCTATCGAAAATTGCGCAAGTATTACAATCAGATGCTAAAAAAGCA
    AATATTGAAATCGACATTAAAAGTGTTGATGACATAGAAGGTTACTTAAAAGACCGTTCT
    GCATGGGATGCAACGATGTATAGTTTCGGAACAATCCCTCGCGGTGATACAGGTTATTTC
    TTTAATCAAGCATATAAAAAAGATGGTGCTATTAATAAAGGAGACTACAATAATAGCAAC
    GTCGATGATTTAATTAATCAATTGAATCATACTGTAGATGTTAAGGAACGTCACAATATT
    TCTAATGATATTATTAAATTATCAAGTCGAGATGTACCAAACAGTTATATTGCTTACAAC
    GATCAAATAGTCGCTGCTAACTCTAAGGTTAAAAATTATAAAGTAACACCTGAAGGTATC
    TATTTAATCGATTATCGAACAACGATTGAACGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1476

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0229 [new locus tag: SA_RS01340 ]
  • symbol: SA0229
  • description: hypothetical protein
  • length: 491
  • theoretical pI: 9.57092
  • theoretical MW: 55457.4
  • GRAVY: -0.670265

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel ABC transporter, nickel/metallophore periplasmic binding protein (TIGR02294; HMM-score: 117.1)
    MetabolismTransport and binding proteinsUnknown substrateABC transporter substrate binding protein, KPN_01854 family (TIGR04028; HMM-score: 42)
  • TheSEED:  
    ABC transporter oligopeptide (TC 3.A.1.5.1) ABC transporter, substrate-binding protein (cluster 5, nickel/peptides/opines) 
    Sex pheromones in Enterococcus faecalis and other Firmicutes ABC transporter, substrate-binding protein (cluster 5, nickel/peptides/opines) 
  • PFAM:
    PBP (CL0177) SBP_bac_5; Bacterial extracellular solute-binding proteins, family 5 Middle (PF00496; HMM-score: 222.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 9.2
    • Extracellular Score: 0.78
    • Internal Helices: 0
  • LocateP: Lipid anchored
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPII)
    • Intracellular Possibility: -0.33
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: VLSGCGS
  • SignalP: Signal peptide length 24 aa
    • Ymax: 0.348
    • Ymax_pos: 24
    • Cmax: 0.167
    • Cmax_pos: 24
    • Smax: 0.913
    • Smax_pos: 10
    • Smean: 0.778
    • D: 0.516
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKFKRLATIFSAVLVLSGCGSMHSSGKDLNISLPLKTKSIAPYETDVPVKIGAAESLFKTNDQGKIEKALVKSYHQPNDTTLDIELKDNIKFQNGQKLTAEKVKSSLENSMKKSDLVKYSLPISSITAKGQKLTIKTNSAYPELVSELANPFMAIYYTDAKSDVNQTPVGTGPYQIKDYKQSRKISLSNFKDYWQGKPKLDHITVTYQEDGNNRVRNLESQKDDLITDVPVNKVHDIENNQNLKVSKESGFRTSLLMYNHTNKKMTKSVREALDHIIDRQGIADHIYQGYAKPATSPFNDKIPYIKEPKLTKQNIEQAKTLLAKDGYTKEHPLKIKLITYDGRPELSKIAQVLQSDAKKANIEIDIKSVDDIEGYLKDRSAWDATMYSFGTIPRGDTGYFFNQAYKKDGAINKGDYNNSNVDDLINQLNHTVDVKERHNISNDIIKLSSRDVPNSYIAYNDQIVAANSKVKNYKVTPEGIYLIDYRTTIER

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Aurelia Hiron, Elise Borezée-Durant, Jean-Christophe Piard, Vincent Juillard
Only one of four oligopeptide transport systems mediates nitrogen nutrition in Staphylococcus aureus.
J. Bacteriol.: 2007, 189(14);5119-29
[PubMed:17496096] [WorldCat.org] [DOI] (P p)
Aurelia Hiron, Brunella Posteraro, Marie Carrière, Laetitia Remy, Cécile Delporte, Marilena La Sorda, Maurizio Sanguinetti, Vincent Juillard, Elise Borezée-Durant
A nickel ABC-transporter of Staphylococcus aureus is involved in urinary tract infection.
Mol. Microbiol.: 2010, 77(5);1246-60
[PubMed:20662775] [WorldCat.org] [DOI] (I p)