From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1120 [new locus tag: SA_RS06335 ]
  • pan locus tag?: SAUPAN003578000
  • symbol: SA1120
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1120 [new locus tag: SA_RS06335 ]
  • symbol: SA1120
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1273076..1273789
  • length: 714
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGTCAGAAATGAATGCGGTATATAACGTTAAACAATACATTTTAAATTTGATTATGCAA
    AATAAATTGGAATATGGTGACCAACTTCCAAGTAATTTATCAATTGCCAGAGAATTAAAT
    GTAAAAACCGACGATGTTTATGAAGCAATTCAGGCATTGATTACTGAACAAGTCATTAAA
    GATAATTTTGAAGAGGGCACAAGTGTTAAATCACTGCCCCCTTTCTTTTATCCATTGAAT
    GAACTTATAAGTATTGGGCAAATGATTAAAAATGCAGGATTTGAATGCGGAACTGAATAC
    TTAAATTTTGATGAGCAACCAGCAACTATGTTAGATGCAAATTTGTTGAGCGTTGAAGAA
    GGATATCCAGTAACCATTATAGAACGATTACGAACTGCCGATGGAGAACCGGTCGTCTAT
    TGTTTAGATAAAATTGCTAAAAAAGAATTAACATGTACAGAGTATCAAATGAGCAATGGA
    TCGATACTAAGTGCGATAAAAGAACAAAGTAATCATAATATTTGTTACGCTGATACAGAA
    ATTGAAGCGGTAAATTATGAACCTCGAATATCCGAAGTACTGAATGCTTCGCCACACGAA
    GGTTTGATTTTATTAAAAATTACGCACTACAATGAATTAGATGAACCTATTTTGTATTCA
    TTAAATTATATGAAAAATAGCTTAGTTCAATTTAAAATCACTAGAAAAATATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    714

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1120 [new locus tag: SA_RS06335 ]
  • symbol: SA1120
  • description: hypothetical protein
  • length: 237
  • theoretical pI: 4.28223
  • theoretical MW: 26979.6
  • GRAVY: -0.223629

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsAnionsphosphonate metabolism transcriptional regulator PhnF (TIGR02325; HMM-score: 74.3)
    Signal transductionRegulatory functionsDNA interactionsphosphonate metabolism transcriptional regulator PhnF (TIGR02325; HMM-score: 74.3)
    Signal transductionRegulatory functionsDNA interactionstrehalose operon repressor (TIGR02404; HMM-score: 65)
    Signal transductionRegulatory functionsDNA interactionsphosphonate utilization transcriptional regulator PhnR (TIGR03337; HMM-score: 51.1)
    MetabolismEnergy metabolismAmino acids and amineshistidine utilization repressor (TIGR02018; HMM-score: 28.1)
    Signal transductionRegulatory functionsDNA interactionshistidine utilization repressor (TIGR02018; HMM-score: 28.1)
  • TheSEED:  
    Bacterial RNA-metabolizing Zn-dependent hydrolases Transcriptional regulator in cluster with Zn-dependent hydrolase 
  • PFAM:
    UTRA (CL0122) UTRA; UTRA domain (PF07702; HMM-score: 93.5)
    HTH (CL0123) GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 33)
    no clan definedIFT57; Intra-flagellar transport protein 57 (PF10498; HMM-score: 15)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.117
    • Ymax_pos: 27
    • Cmax: 0.122
    • Cmax_pos: 27
    • Smax: 0.151
    • Smax_pos: 23
    • Smean: 0.105
    • D: 0.112
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSEMNAVYNVKQYILNLIMQNKLEYGDQLPSNLSIARELNVKTDDVYEAIQALITEQVIKDNFEEGTSVKSLPPFFYPLNELISIGQMIKNAGFECGTEYLNFDEQPATMLDANLLSVEEGYPVTIIERLRTADGEPVVYCLDKIAKKELTCTEYQMSNGSILSAIKEQSNHNICYADTEIEAVNYEPRISEVLNASPHEGLILLKITHYNELDEPILYSLNYMKNSLVQFKITRKI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]