From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1165 [new locus tag: SA_RS06615 ]
  • pan locus tag?: SAUPAN003701000
  • symbol: thrC
  • pan gene symbol?: thrC
  • synonym:
  • product: threonine synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1165 [new locus tag: SA_RS06615 ]
  • symbol: thrC
  • product: threonine synthase
  • replicon: chromosome
  • strand: +
  • coordinates: 1326778..1327839
  • length: 1062
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGAGAAGATGGCAAGGATTAGTAGAAGAGTTTAAAGCACATTTACCAGTAAATGAAAAT
    ACACCAAAATTAACATTGAACGAGGGAAATACACCACTCATTCATTGTGAAAATATGTCT
    AAAATACTAGGTATAGATTTATATGTGAAGTATGAAGGTGCCAATCCGACAGGTTCATTT
    AAAGATCGCGGTATGGTAATGGCTGTGACAAAAGCAAAAGAGCAAGGTAAGAAAATTGTA
    ATATGCGCTTCGACTGGAAATACATCAGCGTCTGCAGCAGCATATGCAGCGAGAGCAGGT
    TTAAAAGCTATCGTCGTAATACCAGAAGGTAAAATTGCATTAGGTAAATTGTCGCAAGCA
    GTAATGTATGGTGCAGAAATCGTTTCTATTGAAGGAAACTTTGATGAAGCTTTAGAAATT
    GTAAAAGAAATTGCAAAAAGTGGCGAAATAGAGCTTGTAAACTCTGTCAATCCATTTAGA
    ATCGAAGGGCAAAAGACAGGCTCATTTGAAATTGTACAACAATTAGACGGTGAAGCACCT
    GATATTTTAGCGATTCCTGTAGGTAATGCAGGTAATATTACTGCATATTGGAAAGGCTTT
    AAAGAATATCATGAAGCTAAAGGATCACAATTGCCGAAAATGTTTGGCTTCCAAGCTGAA
    GGCGCATCACCAATTGTTCAAAATAAAGTCATTAAAAATCCTGAAACGATTGCAACTGCT
    ATTCGAATTGGTAATCCTGCTAGTTGGGATAAGGCGACTAATGCTCTTAAAGAATCAAAT
    GGATTAATAGATAGTGTTACTGATGATGAAATTCTAGAAGCATATCAGTTAATGACAACT
    AAAGAAGGTGTCTTTAGTGAACCAGCAAGTAATGCTTCTATTGCAGGTTTAATTAAATTG
    CATAGACAAGGTAAATTACCTCAAGGTAAAAAAGTAGTTGCTATTTTAACTGGTAATGGA
    TTAAAAGATCCTGATACTGCTATTTCACTACTAGATAATCCGATAAAGCCATTGCAAAAT
    GATAAAGATAGCATTATCGATTATATTAAAGGAGCTTTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1062

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1165 [new locus tag: SA_RS06615 ]
  • symbol: ThrC
  • description: threonine synthase
  • length: 353
  • theoretical pI: 6.1777
  • theoretical MW: 37900.2
  • GRAVY: -0.178187

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismAmino acid biosynthesisAspartate familythreonine synthase (TIGR00260; EC 4.2.3.1; HMM-score: 352.3)
    MetabolismAmino acid biosynthesisPyruvate familythreonine ammonia-lyase (TIGR01127; EC 4.3.1.19; HMM-score: 105.8)
    MetabolismAmino acid biosynthesisPyruvate familythreonine dehydratase (TIGR02079; EC 4.3.1.19; HMM-score: 85.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteate synthase (TIGR03844; EC 2.5.1.76; HMM-score: 78.8)
    MetabolismEnergy metabolismMethanogenesiscysteate synthase (TIGR03844; EC 2.5.1.76; HMM-score: 78.8)
    MetabolismAmino acid biosynthesisSerine familycysteine synthase (TIGR01136; EC 2.5.1.47; HMM-score: 78.7)
    MetabolismAmino acid biosynthesisSerine familycysteine synthase A (TIGR01139; EC 2.5.1.47; HMM-score: 77)
    MetabolismAmino acid biosynthesisPyruvate familythreonine ammonia-lyase, biosynthetic (TIGR01124; EC 4.3.1.19; HMM-score: 72.7)
    MetabolismAmino acid biosynthesisSerine familycysteine synthase B (TIGR01138; EC 2.5.1.47; HMM-score: 69.4)
    ectoine utilization protein EutB (TIGR02991; HMM-score: 60.3)
    Cellular processesCellular processesBiosynthesis of natural products2,3-diaminopropionate biosynthesis protein SbnA (TIGR03945; HMM-score: 54.2)
    MetabolismAmino acid biosynthesisSerine familycystathionine beta-synthase (TIGR01137; EC 4.2.1.22; HMM-score: 52.3)
    MetabolismAmino acid biosynthesisAromatic amino acid familytryptophan synthase, beta subunit (TIGR00263; EC 4.2.1.20; HMM-score: 48.5)
    Unknown functionEnzymes of unknown specificitypyridoxal-phosphate dependent TrpB-like enzyme (TIGR01415; HMM-score: 36.8)
    MetabolismCentral intermediary metabolismOther1-aminocyclopropane-1-carboxylate deaminase (TIGR01274; EC 3.5.99.7; HMM-score: 29.8)
    pyridoxal phosphate-dependent enzymes, D-cysteine desulfhydrase family (TIGR01275; HMM-score: 26.1)
    MetabolismEnergy metabolismOtherdiaminopropionate ammonia-lyase family (TIGR01747; EC 4.3.1.15; HMM-score: 23)
    diaminopropionate ammonia-lyase (TIGR03528; EC 4.3.1.15; HMM-score: 20.1)
  • TheSEED:  
    Amino Acids and DerivativesLysine, threonine, methionine, and cysteineThreonine and Homoserine Biosynthesis Threonine synthase (EC 4.2.3.1) 
  • PFAM:
    no clan definedPALP; Pyridoxal-phosphate dependent enzyme (PF00291; HMM-score: 263)
    PrpR_N; Propionate catabolism activator (PF06506; HMM-score: 13.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.115
    • Ymax_pos: 12
    • Cmax: 0.112
    • Cmax_pos: 62
    • Smax: 0.185
    • Smax_pos: 24
    • Smean: 0.13
    • D: 0.121
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15926910 NCBI
  • RefSeq: NP_374443 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MRRWQGLVEEFKAHLPVNENTPKLTLNEGNTPLIHCENMSKILGIDLYVKYEGANPTGSFKDRGMVMAVTKAKEQGKKIVICASTGNTSASAAAYAARAGLKAIVVIPEGKIALGKLSQAVMYGAEIVSIEGNFDEALEIVKEIAKSGEIELVNSVNPFRIEGQKTGSFEIVQQLDGEAPDILAIPVGNAGNITAYWKGFKEYHEAKGSQLPKMFGFQAEGASPIVQNKVIKNPETIATAIRIGNPASWDKATNALKESNGLIDSVTDDEILEAYQLMTTKEGVFSEPASNASIAGLIKLHRQGKLPQGKKVVAILTGNGLKDPDTAISLLDNPIKPLQNDKDSIIDYIKGAL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CodY
    CodY (TF) important in Amino acid metabolismRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]