From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1461 [new locus tag: SA_RS08235 ]
  • pan locus tag?: SAUPAN004240000
  • symbol: apt
  • pan gene symbol?: apt
  • synonym:
  • product: adenine phosphoribosyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1461 [new locus tag: SA_RS08235 ]
  • symbol: apt
  • product: adenine phosphoribosyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 1668254..1668772
  • length: 519
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGGATTTAAAGCAATACGTATCAGAAGTTCAAGATTGGCCGAAACCAGGTGTTAGTTTC
    AAGGATATTACTACAATTATGGATAATGGTGAAGCATATGGCTATGCAACAGATAAAATT
    GTAGAATACGCAAAAGACAGAGATGTTGATATCGTTGTAGGACCTGAAGCGCGTGGCTTT
    ATCATTGGCTGTCCTGTAGCTTATTCAATGGGGATTGGCTTTGCACCTGTTAGAAAAGAA
    GGGAAATTACCTCGTGAAGTCATTCGTTATGAGTATGACCTAGAATATGGTACAAATGTT
    TTAACAATGCACAAAGATGCAATTAAACCAGGTCAACGTGTGTTAATTACAGATGATTTA
    TTAGCTACTGGTGGTACGATTGAAGCAGCAATAAAATTAGTTGAAAAATTAGGCGGTATC
    GTAGTAGGTATTGCATTTATAATTGAATTGAAATATTTAAATGGTATTGAAAAAATTAAA
    GATTACGATGTTATGAGTTTAATCTCATACGACGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    519

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1461 [new locus tag: SA_RS08235 ]
  • symbol: Apt
  • description: adenine phosphoribosyltransferase
  • length: 172
  • theoretical pI: 4.48452
  • theoretical MW: 19116.9
  • GRAVY: -0.030814

Function[edit source | edit]

  • reaction:
    EC 2.4.2.7?  ExPASy
    Adenine phosphoribosyltransferaseAMP + diphosphate = adenine + 5-phospho-alpha-D-ribose 1-diphosphate
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesSalvage of nucleosides and nucleotidesadenine phosphoribosyltransferase (TIGR01090; EC 2.4.2.7; HMM-score: 230.7)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesispur operon repressor PurR (TIGR01743; HMM-score: 47.6)
    Signal transductionRegulatory functionsDNA interactionspur operon repressor PurR (TIGR01743; HMM-score: 47.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesisorotate phosphoribosyltransferase (TIGR01367; EC 2.4.2.10; HMM-score: 44.1)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesisorotate phosphoribosyltransferase (TIGR00336; EC 2.4.2.10; HMM-score: 37.2)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesSalvage of nucleosides and nucleotidesxanthine phosphoribosyltransferase (TIGR01744; EC 2.4.2.22; HMM-score: 35.5)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisribose-phosphate diphosphokinase (TIGR01251; EC 2.7.6.1; HMM-score: 27.9)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesSalvage of nucleosides and nucleotidesuracil phosphoribosyltransferase (TIGR01091; EC 2.4.2.9; HMM-score: 19.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesSalvage of nucleosides and nucleotideshypoxanthine phosphoribosyltransferase (TIGR01203; EC 2.4.2.8; HMM-score: 14.6)
    Cellular processesCellular processesDNA transformationcomF family protein (TIGR00201; HMM-score: 13.3)
  • TheSEED:  
    Nucleosides and NucleotidesPurinesPurine conversions Adenine phosphoribosyltransferase (EC 2.4.2.7) 
    Regulation and Cell signalingRegulation and Cell signaling - no subcategorycAMP signaling in bacteria Adenine phosphoribosyltransferase (EC 2.4.2.7) 
    Regulation and Cell signaling - no subcategoryStringent Response, (p)ppGpp metabolism Adenine phosphoribosyltransferase (EC 2.4.2.7) 
  • PFAM:
    PRTase-like (CL0533) Pribosyltran; Phosphoribosyl transferase domain (PF00156; HMM-score: 53.7)
    UPRTase; Uracil phosphoribosyltransferase (PF14681; HMM-score: 19.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0865(ppnK)inorganic polyphosphate/ATP-NAD kinase  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA0342hypothetical protein  [1] (data from MRSA252)
    SA0627hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.093
    • Ymax_pos: 35
    • Cmax: 0.114
    • Cmax_pos: 35
    • Smax: 0.105
    • Smax_pos: 28
    • Smean: 0.072
    • D: 0.085
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDLKQYVSEVQDWPKPGVSFKDITTIMDNGEAYGYATDKIVEYAKDRDVDIVVGPEARGFIIGCPVAYSMGIGFAPVRKEGKLPREVIRYEYDLEYGTNVLTMHKDAIKPGQRVLITDDLLATGGTIEAAIKLVEKLGGIVVGIAFIIELKYLNGIEKIKDYDVMSLISYDE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]