From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1582 [new locus tag: SA_RS08915 ]
  • pan locus tag?: SAUPAN004447000
  • symbol: SA1582
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1582 [new locus tag: SA_RS08915 ]
  • symbol: SA1582
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1821125..1821688
  • length: 564
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAAATTAGAACGTATACTCCCTTTTTCAAAAACACTTATTAAACAACATATAACACCA
    GAAAGTATTGTTGTGGACGCAACTTGCGGTAACGGCAATGACACTTTATTTTTAGCCGAA
    CAAGTACCAGAAGGACATGTTTATGGTTTCGACATTCAAGATTTAGCTTTGGAAAATACA
    CGTGATAAAGTTAAGGATTTCAATCATGTTTCTTTAATAAAAGATGGACATGAAAATATT
    GAACATCATATAAATGATGCACATAAAGGTCATATTGATGCAGCCATCTTTAACCTAGGT
    TATTTGCCTAAAGGTGATAAATCTATCGTGACAAAGCCTGACACGACAATCCAAGCTATT
    AATTCATTGCTATCATTAATGTCAATTGAAGGTATTATTGTACTTGTTATATATCATGGT
    CATAGCGAAGGACAAATTGAGAAGCATGCATTGCTTGATTACTTGAGTACTTTGGATCAA
    AAGCATGCGCAAGTTTTGCAATATCAATTTTTAAACCAACGTAATCATGCTCCATTCATT
    TGTGCCATAGAAAAAATTTCTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    564

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1582 [new locus tag: SA_RS08915 ]
  • symbol: SA1582
  • description: hypothetical protein
  • length: 187
  • theoretical pI: 6.31001
  • theoretical MW: 20992.8
  • GRAVY: -0.181283

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modification16S rRNA (cytosine(1402)-N(4))-methyltransferase (TIGR00006; EC 2.1.1.199; HMM-score: 31)
    Genetic information processingProtein fateProtein modification and repairprotein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 21.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 20.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinonedemethylmenaquinone methyltransferase (TIGR02752; EC 2.1.1.163; HMM-score: 20.5)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationputative protein-(glutamine-N5) methyltransferase, unknown substrate-specific (TIGR03704; EC 2.1.1.-; HMM-score: 20.5)
    Genetic information processingProtein synthesistRNA and rRNA base modification23S rRNA (uracil-5-)-methyltransferase RumA (TIGR00479; EC 2.1.1.-; HMM-score: 19.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinmalonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 15.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 15)
    2-ketoarginine methyltransferase (TIGR04543; EC 2.1.1.243; HMM-score: 14.8)
    Unknown functionEnzymes of unknown specificitytRNA (cmo5U34)-methyltransferase (TIGR00740; EC 2.1.1.-; HMM-score: 14.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllmagnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 11.4)
  • TheSEED:  
    Putative rRNA methylase YtqB 
  • PFAM:
    NADP_Rossmann (CL0063) rRNA_methylase; Putative rRNA methylase (PF06962; HMM-score: 164.5)
    Methyltransf_5; MraW methylase family (PF01795; HMM-score: 35.9)
    Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 35.1)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 33.7)
    MTS; Methyltransferase small domain (PF05175; HMM-score: 20.2)
    Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 19.4)
    Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 18.9)
    Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 15.8)
    TPMT; Thiopurine S-methyltransferase (TPMT) (PF05724; HMM-score: 15)
    Methyltransf_4; Putative methyltransferase (PF02390; HMM-score: 13.8)
    Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 13.3)
    Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 12.9)
    GCD14; tRNA methyltransferase complex GCD14 subunit (PF08704; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.185
    • Ymax_pos: 23
    • Cmax: 0.116
    • Cmax_pos: 39
    • Smax: 0.381
    • Smax_pos: 21
    • Smean: 0.296
    • D: 0.228
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKLERILPFSKTLIKQHITPESIVVDATCGNGNDTLFLAEQVPEGHVYGFDIQDLALENTRDKVKDFNHVSLIKDGHENIEHHINDAHKGHIDAAIFNLGYLPKGDKSIVTKPDTTIQAINSLLSLMSIEGIIVLVIYHGHSEGQIEKHALLDYLSTLDQKHAQVLQYQFLNQRNHAPFICAIEKIS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]