From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1650 [new locus tag: SA_RS09325 ]
  • pan locus tag?: SAUPAN004756000
  • symbol: hemY
  • pan gene symbol?: hemY
  • synonym:
  • product: protoporphyrinogen oxidase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1650 [new locus tag: SA_RS09325 ]
  • symbol: hemY
  • product: protoporphyrinogen oxidase
  • replicon: chromosome
  • strand: -
  • coordinates: 1883870..1885270
  • length: 1401
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    GTGACTAAATCAGTGGCTATTATAGGAGCGGGGATAACAGGTTTATCAAGTGCATATTTT
    TTAAAACAGCAAGATCCTAATATTGATGTAACCATCTTTGAAGCATCGAATCGTCCGGGG
    GGAAAGATTCAATCGTATCGTAAAGATGGTTATATGATTGAACTAGGGCCTGAATCTTAT
    TTAGGTAGAAAAACGATTATGACAGAATTAGCGAAAGATATTGGATTAGAACAAGATATT
    GTTACAAATACGACTGGACAATCATATATTTTTGCGAAAAATAAATTATATCCGATTCCA
    GGTGGTTCAATTATGGGTATTCCAACAGATATTAAACCATTTGTTACTACAAAATTAATA
    TCGCCACTTGGTAAATTAAGAGCAGGATTAGATTTAATCAAAAAGCCTATACAAATGCAA
    GATGGTGACATTTCTGTTGGTGCATTTTTCAGAGCAAGATTAGGTAATGAGGTACTTGAG
    AACTTAATTGAGCCTTTAATGGGTGGTATTTATGGTACCGATATTGATAAATTAAGTTTG
    ATGAGTACGTTTCCTAATTTTAAAGAAAAAGAAGAGGCATTCGGAAGTCTGATAAAAGGT
    ATGAAGGATGAGAAAAATAAGCGTCTGAAACAAAGACAATTATATCCTGGCGCACCAAAA
    GGACAATTCAAACAATTTAAGCATGGTTTAAGCTCATTTATTGAAGCATTAGAACAAGAT
    GTGAAAAATAAAGGTGTGACAATACGCTACAATACGTCAGTGGATGATATTATTACATCT
    CAAAAGCAATATAAAATTGTTTACAGTAATCAACAAGAAGATGTATTCGATGGGGTATTA
    GTGACAACACCGCATCAAGTCTTTTTGAATTGGTTCGGACAAGATCCAGCATTTGATTAC
    TTTAAAACGATGGATAGTACGACTGTTGCAACTGTTGTATTGGCATTTGATGAAAAAGAC
    ATTGAAAATACTTATGATGGTACTGGCTTCGTGATTGCGAGAACGAGTGATACAGACATT
    ACCGCATGTACTTGGACATCGAAAAAATGGCCATTTACTACACCAGAAGGTAAGGTTTTG
    ATTCGTGCGTATGTAGGTAAACCAGGTGATACTGTGGTTGATGATCATACAGATAATGAA
    TTAGTATCGATTGTACGTAGAGATTTAAGTCAAATGATGACATTTAAAGGTGATCCTGAA
    TTTACAATTGTCAATCGTTTGCCGAAAAGTATGCCACAGTACCATGTCGGTCATATTCAA
    CAAATTAGACAGATTCAAGCACATATTAAACAAACATATCCACGACTTAGAGTAACTGGT
    GCATCTTTTGAAGCGGTTGGACTACCTGATTGTATTACACAAGGTAAAGTTGCTGCTGAA
    GAAGTAATCGCAGAGTTGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1401

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1650 [new locus tag: SA_RS09325 ]
  • symbol: HemY
  • description: protoporphyrinogen oxidase
  • length: 466
  • theoretical pI: 7.14632
  • theoretical MW: 51944.1
  • GRAVY: -0.298498

Function[edit source | edit]

  • reaction:
    EC 1.3.3.4?  ExPASy
    Protoporphyrinogen oxidaseProtoporphyrinogen-IX + 3 O2 = protoporphyrin-IX + 3 H2O2
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprotoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 382.9)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 60.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 44.1)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 37.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 30.6)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 30.4)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 22.1)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 21.8)
    putative aminophosphonate oxidoreductase (TIGR03329; HMM-score: 21.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 19.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 19.4)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 16.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 16.6)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 15.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercarotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 15.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 15)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 14.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 14.1)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 13.8)
    flavin-dependent oxidoreductase, MSMEG_0569 family (TIGR04046; HMM-score: 13)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 12.9)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 12.4)
    MetabolismEnergy metabolismTCA cyclemalate dehydrogenase (acceptor) (TIGR01320; EC 1.1.5.4; HMM-score: 11.4)
    lycopene cyclase (TIGR01789; HMM-score: 11.2)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 11.1)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 11.1)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsTetrapyrrolesCPO analysis Protoporphyrinogen IX oxidase, aerobic, HemY (EC 1.3.3.4) 
  • PFAM:
    NADP_Rossmann (CL0063) Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 205.3)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 55.5)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 43.4)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 31.5)
    MCRA; MCRA family (PF06100; HMM-score: 28.6)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 28.3)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 27.1)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 26.5)
    Thi4; Thi4 family (PF01946; HMM-score: 25.9)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 16.9)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 14.2)
    Mqo; Malate:quinone oxidoreductase (Mqo) (PF06039; HMM-score: 13.5)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 13.2)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 12.8)
    Glu_dehyd_C; Glucose dehydrogenase C-terminus (PF16912; HMM-score: 12.6)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 12.2)
    Prenylcys_lyase; Prenylcysteine lyase (PF07156; HMM-score: 11.8)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.83
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.185
    • Ymax_pos: 24
    • Cmax: 0.127
    • Cmax_pos: 19
    • Smax: 0.463
    • Smax_pos: 20
    • Smean: 0.251
    • D: 0.211
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15927406 NCBI
  • RefSeq: NP_374939 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTKSVAIIGAGITGLSSAYFLKQQDPNIDVTIFEASNRPGGKIQSYRKDGYMIELGPESYLGRKTIMTELAKDIGLEQDIVTNTTGQSYIFAKNKLYPIPGGSIMGIPTDIKPFVTTKLISPLGKLRAGLDLIKKPIQMQDGDISVGAFFRARLGNEVLENLIEPLMGGIYGTDIDKLSLMSTFPNFKEKEEAFGSLIKGMKDEKNKRLKQRQLYPGAPKGQFKQFKHGLSSFIEALEQDVKNKGVTIRYNTSVDDIITSQKQYKIVYSNQQEDVFDGVLVTTPHQVFLNWFGQDPAFDYFKTMDSTTVATVVLAFDEKDIENTYDGTGFVIARTSDTDITACTWTSKKWPFTTPEGKVLIRAYVGKPGDTVVDDHTDNELVSIVRRDLSQMMTFKGDPEFTIVNRLPKSMPQYHVGHIQQIRQIQAHIKQTYPRLRVTGASFEAVGLPDCITQGKVAAEEVIAEL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA1678 (PerR*)
    PerR* (TF) important in Oxidative stress responseRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]