From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1736 [new locus tag: SA_RS09970 ]
  • pan locus tag?: SAUPAN004956000
  • symbol: aldH
  • pan gene symbol?: aldH
  • synonym:
  • product: aldehyde dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1736 [new locus tag: SA_RS09970 ]
  • symbol: aldH
  • product: aldehyde dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 1988703..1990082
  • length: 1380
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGAATATCATTGAGCAAAAATTTTATGACAGTAAAGCTTTTTTCAATACACAACAAACT
    AAAGATATTAGTTTTAGAAAAGATCAATTAAAGAAGTTAAGCAAAGCTATTAAATCATAC
    GAGAGCGATATTTTAGAAGCACTATATACAGATTTAGGAAAAAATAAAGTCGAAGCTTAT
    GCTACTGAAATTGGCATAACTTTGAAAAGTATCAAAAATGCCCGTAAGGAACTTAAAAAC
    TGGACTAAAACAAAAAATGTAGACACACCTTTATATTTATTTCCAACAAAAAGCTATATC
    AAAAAAGAACCTTATGGAACAGTTTTGATCATTGCACCATTTAACTATCCTTTTCAACTA
    GTATTCGAACCTTTAATCGGTGCTATTGCAGCAGGTAATACAGCAATTATTAAACCATCT
    GAGTTGACACCAAATGTTGCACGAGTGATTAAACGATTAATCAATGAAACATTTGATGCA
    AATTACATTGAAGTTATTGAGGGAGGAATTGAAGAAACGCAAACGTTAATTCACTTACCT
    TTTGACTATGTCTTCTTTACAGGAAGTGAAAATGTAGGCAAAATCGTTTATCAAGCTGCC
    AGCGAAAATTTAGTTCCTGTGACATTAGAAATGGGTGGTAAATCTCCAGTCATCGTTGAT
    GAAACAGCGAATATTAAAGTTGCTAGTGAGCGCATTTGTTTTGGGAAATTCACTAATGCC
    GGCCAAACATGTGTTGCACCAGATTACATTTTAGTACACGAATCTGTAAAAGATGATTTA
    ATCACAGCCCTATCAAAAACGTTGCGTGAATTTTATGGTCAAAATATACAACAAAGTCCA
    GATTATGGCCGCATTGTAAACCTTAAACATTATCATCGTCTGACTTCATTACTTAACAGT
    GCACAAATGAATATTGTATTTGGTGGTCATAGTGATGAGGATGAACGTTATATAGAACCA
    ACATTGTTAGATCACGTTACAAGTGATTCAGCAATTATGCAAGAAGAAATTTTTGGTCCT
    ATCTTACCGATTTTAACGTATCAGTCATTGGATGAAGCAATAGCCTTTATTCACCAAAGA
    CCAAAACCTTTGAGTTTATATTTATTTAGCGAAGATGAAAATGCTACACAACGTGTAATA
    AACGAGTTATCATTTGGCGGCGGCGCTATTAATGATACATTGATGCACCTAGCGAATCCT
    AAATTACCATTTGGTGGTGTTGGCGCCTCAGGTATGGGACGCTATCATGGTAAATATTCA
    TTCGACACTTTTACACATGAAAAAAGCTACATTTTCAAATCTACACGATTAGAATCAGGT
    GTCCATTTACCACCATATAAAGGTAAATTTAAATACATCAAAGCTTTCTTTAAAAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1736 [new locus tag: SA_RS09970 ]
  • symbol: AldH
  • description: aldehyde dehydrogenase
  • length: 459
  • theoretical pI: 7.12628
  • theoretical MW: 51727.8
  • GRAVY: -0.236166

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismCentral intermediary metabolismOthersuccinate-semialdehyde dehydrogenase (TIGR01780; EC 1.2.1.-; HMM-score: 209.1)
    Cellular processesCellular processesAdaptations to atypical conditionsbetaine-aldehyde dehydrogenase (TIGR01804; EC 1.2.1.8; HMM-score: 199.7)
    Unknown functionEnzymes of unknown specificityaldehyde dehydrogenase, Rv0768 family (TIGR04284; EC 1.2.1.-; HMM-score: 187.5)
    5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase (TIGR02299; EC 1.2.1.60; HMM-score: 181.6)
    MetabolismEnergy metabolismOther2-hydroxymuconic semialdehyde dehydrogenase (TIGR03216; EC 1.2.1.-; HMM-score: 166.4)
    MetabolismEnergy metabolismAmino acids and aminessuccinylglutamate-semialdehyde dehydrogenase (TIGR03240; EC 1.2.1.71; HMM-score: 153.8)
    putative phosphonoacetaldehyde dehydrogenase (TIGR03250; EC 1.2.1.-; HMM-score: 153.3)
    MetabolismEnergy metabolismAmino acids and aminesputative delta-1-pyrroline-5-carboxylate dehydrogenase (TIGR01237; EC 1.2.1.88; HMM-score: 145.6)
    1-pyrroline dehydrogenase (TIGR03374; EC 1.2.1.19; HMM-score: 145.4)
    MetabolismEnergy metabolismAmino acids and aminesmethylmalonate-semialdehyde dehydrogenase (acylating) (TIGR01722; EC 1.2.1.27; HMM-score: 121.6)
    MetabolismEnergy metabolismAmino acids and aminesdelta-1-pyrroline-5-carboxylate dehydrogenase (TIGR01238; EC 1.2.1.88; HMM-score: 99.6)
    MetabolismEnergy metabolismAmino acids and amines1-pyrroline-5-carboxylate dehydrogenase (TIGR01236; EC 1.2.1.88; HMM-score: 91.8)
    phenylacetic acid degradation protein paaN (TIGR02278; HMM-score: 71.9)
    phenylacetic acid degradation protein paaN (TIGR02288; HMM-score: 45.6)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate-5-semialdehyde dehydrogenase (TIGR00407; EC 1.2.1.41; HMM-score: 25.2)
    acetaldehyde dehydrogenase (acetylating) (TIGR02518; EC 1.2.1.10; HMM-score: 21.2)
    Signal transductionRegulatory functionsDNA interactionsCRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 16.2)
    Cellular processesCellular processesSporulation and germinationstage III sporulation protein AB (TIGR02833; HMM-score: 11.8)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismMethylglyoxal Metabolism Aldehyde dehydrogenase (EC 1.2.1.3) 
    Central carbohydrate metabolismPyruvate metabolism II: acetyl-CoA, acetogenesis from pyruvate Aldehyde dehydrogenase (EC 1.2.1.3) 
    Fatty Acids, Lipids, and IsoprenoidsPhospholipidsGlycerolipid and Glycerophospholipid Metabolism in Bacteria Aldehyde dehydrogenase (EC 1.2.1.3) 
  • PFAM:
    ALDH-like (CL0099) Aldedh; Aldehyde dehydrogenase family (PF00171; HMM-score: 318.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA1287(asnC)asparaginyl-tRNA synthetase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0869(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA2023(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA1528hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.105
    • Ymax_pos: 60
    • Cmax: 0.12
    • Cmax_pos: 60
    • Smax: 0.138
    • Smax_pos: 2
    • Smean: 0.089
    • D: 0.099
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15927494 NCBI
  • RefSeq: NP_375027 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNIIEQKFYDSKAFFNTQQTKDISFRKDQLKKLSKAIKSYESDILEALYTDLGKNKVEAYATEIGITLKSIKNARKELKNWTKTKNVDTPLYLFPTKSYIKKEPYGTVLIIAPFNYPFQLVFEPLIGAIAAGNTAIIKPSELTPNVARVIKRLINETFDANYIEVIEGGIEETQTLIHLPFDYVFFTGSENVGKIVYQAASENLVPVTLEMGGKSPVIVDETANIKVASERICFGKFTNAGQTCVAPDYILVHESVKDDLITALSKTLREFYGQNIQQSPDYGRIVNLKHYHRLTSLLNSAQMNIVFGGHSDEDERYIEPTLLDHVTSDSAIMQEEIFGPILPILTYQSLDEAIAFIHQRPKPLSLYLFSEDENATQRVINELSFGGGAINDTLMHLANPKLPFGGVGASGMGRYHGKYSFDTFTHEKSYIFKSTRLESGVHLPPYKGKFKYIKAFFKN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]