From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1894 [new locus tag: SA_RS10900 ]
  • pan locus tag?: SAUPAN005373000
  • symbol: thiE
  • pan gene symbol?: thiE
  • synonym:
  • product: thiamine-phosphate pyrophosphorylase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1894 [new locus tag: SA_RS10900 ]
  • symbol: thiE
  • product: thiamine-phosphate pyrophosphorylase
  • replicon: chromosome
  • strand: -
  • coordinates: 2147041..2147682
  • length: 642
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGTTTAACCAATCGTATCTAAATGTGTATTTTATTTGTGGGACCTCCGATGTTCCGAGT
    CATCGAACTATTCATGAAGTATTAGAAGCAGCATTAAAGGCAGGGATTACACTTTTCCAA
    TTTCGAGAAAAGGGTGAATCAGCTTTAAAAGGAAACGATAAACTTGTATTAGCTAAAGAA
    TTACAGCATCTCTGTCATCAATATGATGTGCCTTTTATCGTTAATGATGATGTATCCTTG
    GCAAAAGAAATTAACGCGGATGGTATACATGTCGGTCAAGATGATGCGAAAGTCAAAGAG
    ATAGCACAATATTTCACTGATAAAATTATTGGACTTAGTATTAGTGATTTAGATGAGTAT
    GCAAAATCTGATTTAACTCATGTTGATTATATAGGTGTTGGACCAATCTATCCTACGCCG
    TCGAAGCATGACGCGCATATACCAGTAGGTCCAGAAATGATTGCAACGTTTAAAGAAATG
    AATCCGCAACTACCGATTGTAGCTATTGGCGGTATCAATACTAATAATGTGGCGCCGATT
    GTAGAAGCAGGTGCCAATGGAATTTCAGTCATTTCAGCCATTTCTAAAAGTGAAAATATT
    GAAAAGACTGTTAATCGATTCAAAGATTTTTTTAATAATTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    642

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1894 [new locus tag: SA_RS10900 ]
  • symbol: ThiE
  • description: thiamine-phosphate pyrophosphorylase
  • length: 213
  • theoretical pI: 5.06131
  • theoretical MW: 23398.4
  • GRAVY: -0.110798

Function[edit source | edit]

  • reaction:
    EC 2.5.1.3?  ExPASy
    Thiamine phosphate synthase4-amino-2-methyl-5-diphosphomethylpyrimidine + 2-((2R,5Z)-2-carboxy-4-methylthiazol-5(2H)-ylidene)ethyl phosphate = diphosphate + thiamine phosphate + CO24-amino-2-methyl-5-diphosphomethylpyrimidine + 2-(2-carboxy-4-methylthiazol-5-yl)ethyl phosphate = diphosphate + thiamine phosphate + CO24-amino-2-methyl-5-diphosphomethylpyrimidine + 4-methyl-5-(2-phosphono-oxyethyl)thiazole = diphosphate + thiamine phosphate
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiamine-phosphate diphosphorylase (TIGR00693; EC 2.5.1.3; HMM-score: 211.9)
    MetabolismEnergy metabolismPentose phosphate pathwayribulose-phosphate 3-epimerase (TIGR01163; EC 5.1.3.1; HMM-score: 20.4)
    phosphoglycerol geranylgeranyltransferase (TIGR01769; EC 2.5.1.41; HMM-score: 18)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridoxinepyridoxal 5'-phosphate synthase, synthase subunit Pdx1 (TIGR00343; HMM-score: 15.2)
    geranylgeranylglyceryl phosphate synthase family protein (TIGR01768; EC 2.5.1.-; HMM-score: 13.7)
    3-hexulose-6-phosphate synthase (TIGR03128; EC 4.1.2.43; HMM-score: 12.8)
    Genetic information processingProtein synthesistRNA aminoacylationO-phosphoseryl-tRNA(Sec) selenium transferase (TIGR03531; EC 2.9.1.2; HMM-score: 11)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsCofactors, Vitamins, Prosthetic Groups, Pigments - no subcategoryThiamin biosynthesis Thiamin-phosphate pyrophosphorylase (EC 2.5.1.3) 
  • PFAM:
    TIM_barrel (CL0036) TMP-TENI; Thiamine monophosphate synthase (PF02581; HMM-score: 199.1)
    DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 24.4)
    ThiG; Thiazole biosynthesis protein ThiG (PF05690; HMM-score: 19.3)
    PLP_aminotran (CL0061) SepSecS; O-phosphoseryl-tRNA(Sec) selenium transferase, SepSecS (PF05889; HMM-score: 18.4)
    TIM_barrel (CL0036) NanE; Putative N-acetylmannosamine-6-phosphate epimerase (PF04131; HMM-score: 15.9)
    Ribul_P_3_epim; Ribulose-phosphate 3 epimerase family (PF00834; HMM-score: 13.8)
    DHO_dh; Dihydroorotate dehydrogenase (PF01180; HMM-score: 13.6)
    QRPTase_C; Quinolinate phosphoribosyl transferase, C-terminal domain (PF01729; HMM-score: 12.9)
    Peptidase_CA (CL0125) Peptidase_C78; Peptidase family C78 (PF07910; HMM-score: 12.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.13
    • Ymax_pos: 23
    • Cmax: 0.134
    • Cmax_pos: 23
    • Smax: 0.161
    • Smax_pos: 24
    • Smean: 0.126
    • D: 0.129
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MFNQSYLNVYFICGTSDVPSHRTIHEVLEAALKAGITLFQFREKGESALKGNDKLVLAKELQHLCHQYDVPFIVNDDVSLAKEINADGIHVGQDDAKVKEIAQYFTDKIIGLSISDLDEYAKSDLTHVDYIGVGPIYPTPSKHDAHIPVGPEMIATFKEMNPQLPIVAIGGINTNNVAPIVEAGANGISVISAISKSENIEKTVNRFKDFFNN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: TPP
    TPP (RNA) important in Thiamine biosynthesisRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]