From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1907 [new locus tag: SA_RS10975 ]
  • pan locus tag?: SAUPAN005396000
  • symbol: atpA
  • pan gene symbol?: atpA
  • synonym:
  • product: ATP synthase F0F1 subunit alpha

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1907 [new locus tag: SA_RS10975 ]
  • symbol: atpA
  • product: ATP synthase F0F1 subunit alpha
  • replicon: chromosome
  • strand: -
  • coordinates: 2157930..2159438
  • length: 1509
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGGCCATAAAAGCTGAAGAAATCAGTGCATTACTTCGCTCACAAATTGAAAATTATGAG
    TCAGAAATGTCCGTAACTGATGTAGGTACTGTATTACAAATTGGTGATGGTATTGCATTA
    ATTCACGGATTAAATGACGTTATGGCTGGTGAGCTAGTAGAATTCCATAACGGCGTACTT
    GGTTTAGCCCAAAACCTTGAAGAGTCAAACGTGGGTGTGGTTATTTTAGGACCATATACA
    GGTATTACTGAAGGTGACGAAGTTAAACGTACTGGTCGTATCATGGAAGTACCAGTAGGT
    GAAGAACTAATCGGAAGAGTTGTTAATCCATTAGGACAACCTATTGATGGACAAGGACCG
    ATTAACACAACTAAAACACGTCCAGTAGAGAAAAAAGCTACTGGTGTAATGGATCGTAAA
    TCAGTAGATGAGCCATTACAAACAGGTATCAAAGCAATTGATGCTTTAGTACCAATTGGT
    AGAGGTCAACGTGAGTTAATCATTGGTGACCGTCAAACAGGTAAAACAACAATTGCAATT
    GACACAATTTTGAACCAAAAAGATCAAGGTACGATTTGTATCTATGTTGCTATTGGTCAA
    AAAGATTCAACAGTAAGAGCAAATGTTGAAAAGTTAAGACAAGCAGGCGCTTTAGACTAC
    ACTATTGTTGTAGCAGCATCAGCTTCTGAACCTTCTCCATTATTATATATTGCACCATAT
    TCAGGTGTAACAATGGGTGAAGAATTCATGTTTAACGGTAAACATGTTTTAATCGTTTAT
    GATGATTTAACTAAACAAGCAGCAGCTTATCGTGAGTTATCATTATTATTACGTAGACCT
    CCAGGTCGTGAAGCATACCCAGGTGACGTATTCTACTTACATAGTAGATTATTAGAAAGA
    GCAGCAAAATTAAACGATGACTTAGGTGGCGGTTCAATTACTGCATTACCAATTATCGAA
    ACACAAGCTGGTGATATTTCAGCTTATGTACCAACAAACGTTATTTCAATTACAGATGGA
    CAAATCTTCTTACAATCTGATTTATTCTTCTCAGGTGTAAGACCAGCGATTAATGCCGGA
    CAATCTGTATCTCGTGTTGGTGGATCTGCACAAATTAAAGCAATGAAGAAAGTTGCTGGT
    ACGTTACGTCTTGACTTAGCGTCATACAGAGAACTTGAATCATTTGCACAATTCGGTTCA
    GACCTTGATGAATTTACTGCAAGTAAATTAGAACGTGGTAAACGTACCGTTGAAGTCTTA
    AAACAAGATCAAAACAAACCATTACCAGTCGAACACCAAGTGTTGATTATTTATGCATTA
    ACAAAAGGATATTTAGATGATATTCCAGTTGTAGATATCACACGTTTTGAAGACGAGTTA
    AACCACTGGGCAGAATCAAATGCTACTGAACTGTTAAATGAAATCAGAGAAACTGGTGGC
    TTACCAGATGCTGAGAAGTTTGACACAGCAATTAACGAATTCAAAAAAAGCTTTAGCAAA
    TCTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1509

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1907 [new locus tag: SA_RS10975 ]
  • symbol: AtpA
  • description: ATP synthase F0F1 subunit alpha
  • length: 502
  • theoretical pI: 4.62947
  • theoretical MW: 54583.6
  • GRAVY: -0.147809

Function[edit source | edit]

  • reaction:
    EC 3.6.3.14?  ExPASy
    H+-transporting two-sector ATPaseATP + H2O + H+(In) = ADP + phosphate + H+(Out)
  • TIGRFAM:
    MetabolismEnergy metabolismATP-proton motive force interconversionATP synthase F1, alpha subunit (TIGR00962; EC 3.6.3.14; HMM-score: 836.6)
    alternate F1F0 ATPase, F1 subunit alpha (TIGR03324; EC 3.6.3.-; HMM-score: 648.9)
    Cellular processesCellular processesPathogenesistype III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 205.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 205.7)
    Cellular processesCellular processesChemotaxis and motilityflagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 199.1)
    MetabolismEnergy metabolismATP-proton motive force interconversionATPase, FliI/YscN family (TIGR01026; EC 3.6.3.14; HMM-score: 187.6)
    Cellular processesCellular processesChemotaxis and motilityflagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 183.5)
    flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 173.7)
    MetabolismEnergy metabolismATP-proton motive force interconversionATP synthase archaeal, B subunit (TIGR01041; EC 3.6.3.14; HMM-score: 147.9)
    MetabolismEnergy metabolismATP-proton motive force interconversionATP synthase F1, beta subunit (TIGR01039; EC 3.6.3.14; HMM-score: 130.1)
    alternate F1F0 ATPase, F1 subunit beta (TIGR03305; EC 3.6.3.-; HMM-score: 121.2)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsV-type ATPase, B subunit (TIGR01040; EC 3.6.3.14; HMM-score: 119.1)
    MetabolismEnergy metabolismATP-proton motive force interconversionATP synthase archaeal, A subunit (TIGR01043; EC 3.6.3.14; HMM-score: 69.6)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsV-type ATPase, A subunit (TIGR01042; EC 3.6.3.14; HMM-score: 51.8)
    Genetic information processingTranscriptionTranscription factorstranscription termination factor Rho (TIGR00767; EC 3.6.4.-; HMM-score: 19.5)
    KaiC domain protein, AF_0351 family (TIGR03880; HMM-score: 16.3)
    KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 15.3)
    KaiC domain protein, Ph0284 family (TIGR03877; HMM-score: 13)
  • TheSEED:  
    RespirationATP synthasesF0F1-type ATP synthase ATP synthase alpha chain (EC 3.6.3.14) 
  • PFAM:
    P-loop_NTPase (CL0023) ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 246.9)
    no clan definedATP-synt_ab_C; ATP synthase alpha/beta chain, C terminal domain (PF00306; HMM-score: 153.1)
    HAS-barrel (CL0275) ATP-synt_ab_N; ATP synthase alpha/beta family, beta-barrel domain (PF02874; HMM-score: 67.1)
    P-loop_NTPase (CL0023) ATPase; KaiC (PF06745; HMM-score: 27.1)
    HAS-barrel (CL0275) HAS-barrel; HAS barrel domain (PF09378; HMM-score: 21.8)
    P-loop_NTPase (CL0023) RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 13.1)
    AAA_14; AAA domain (PF13173; HMM-score: 12.9)
    AAA_25; AAA domain (PF13481; HMM-score: 11.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.128
    • Ymax_pos: 50
    • Cmax: 0.187
    • Cmax_pos: 50
    • Smax: 0.139
    • Smax_pos: 26
    • Smean: 0.082
    • D: 0.11
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAIKAEEISALLRSQIENYESEMSVTDVGTVLQIGDGIALIHGLNDVMAGELVEFHNGVLGLAQNLEESNVGVVILGPYTGITEGDEVKRTGRIMEVPVGEELIGRVVNPLGQPIDGQGPINTTKTRPVEKKATGVMDRKSVDEPLQTGIKAIDALVPIGRGQRELIIGDRQTGKTTIAIDTILNQKDQGTICIYVAIGQKDSTVRANVEKLRQAGALDYTIVVAASASEPSPLLYIAPYSGVTMGEEFMFNGKHVLIVYDDLTKQAAAYRELSLLLRRPPGREAYPGDVFYLHSRLLERAAKLNDDLGGGSITALPIIETQAGDISAYVPTNVISITDGQIFLQSDLFFSGVRPAINAGQSVSRVGGSAQIKAMKKVAGTLRLDLASYRELESFAQFGSDLDEFTASKLERGKRTVEVLKQDQNKPLPVEHQVLIIYALTKGYLDDIPVVDITRFEDELNHWAESNATELLNEIRETGGLPDAEKFDTAINEFKKSFSKSE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]