From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1939 [new locus tag: SA_RS11140 ]
  • pan locus tag?: SAUPAN005434000
  • symbol: SA1939
  • pan gene symbol?: deoC2
  • synonym:
  • product: deoxyribose-phosphate aldolase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1939 [new locus tag: SA_RS11140 ]
  • symbol: SA1939
  • product: deoxyribose-phosphate aldolase
  • replicon: chromosome
  • strand: -
  • coordinates: 2188926..2189588
  • length: 663
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATAGTGCAAAATTGATTGATCACACTTTATTGAAGCCTGAGTCAACACGTACGCAA
    ATCGATCAAATCATCGATGAAGCGAAAGCATACCATTTTAAATCTGTATGTGTGAATCCA
    ACGCATGTTAAATATGCAGCAGAGCGACTAGCTGATTCAGAGGTGTTAGTTTGTACGGTA
    ATAGGATTCCCATTAGGTGCATCGACAACTGCGACGAAAGCATTTGAAACAGAAGATGCG
    ATTCAAAATGGTGCAGATGAAATTGACATGGTCATCAACATCGGCGCATTAAAAGATGGA
    CGTTTTGATGATGTACAACAAGACATTGAAGCAGTGGTGAAAGCTGCGAAAGGTCACACA
    GTAAAAGTGATTATTGAGACGGTATTGTTGGACCATGACGAAATCGTAAAAGCGAGTGAA
    TTAACAAAAGTGGCTGGTGCGGACTTCGTTAAAACTTCAACAGGTTTTGCAGGTGGCGGT
    GCGACTGCAGAAGACGTTAAATTAATGAAAGATACAGTAGGTGCTGATGTAGAAGTAAAA
    GCATCAGGTGGCGTACGTAATTTAGAAGATTTCAATAAAATGGTTGAAGCAGGTGCGACA
    CGTATTGGTGCGAGCGCAGGCGTTCAAATTATGCAAGGTTTAGAAGCAGATTCAGATTAC
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    663

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1939 [new locus tag: SA_RS11140 ]
  • symbol: SA1939
  • description: deoxyribose-phosphate aldolase
  • length: 220
  • theoretical pI: 4.47623
  • theoretical MW: 23341.2
  • GRAVY: -0.0640909

Function[edit source | edit]

  • reaction:
    EC 4.1.2.4?  ExPASy
    Deoxyribose-phosphate aldolase2-deoxy-D-ribose 5-phosphate = D-glyceraldehyde 3-phosphate + acetaldehyde
  • TIGRFAM:
    MetabolismEnergy metabolismOtherdeoxyribose-phosphate aldolase (TIGR00126; EC 4.1.2.4; HMM-score: 286.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherdeoxyribose-phosphate aldolase (TIGR00126; EC 4.1.2.4; HMM-score: 286.3)
    predicted phospho-2-dehydro-3-deoxyheptonate aldolase (TIGR01949; EC 4.2.1.-; HMM-score: 18.5)
  • TheSEED:  
    CarbohydratesMonosaccharidesDeoxyribose and Deoxynucleoside Catabolism Deoxyribose-phosphate aldolase (EC 4.1.2.4) 
  • PFAM:
    TIM_barrel (CL0036) DeoC; DeoC/LacD family aldolase (PF01791; HMM-score: 92.3)
    His_biosynth; Histidine biosynthesis protein (PF00977; HMM-score: 16.5)
    G3P_antiterm; Glycerol-3-phosphate responsive antiterminator (PF04309; HMM-score: 15.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.136
    • Ymax_pos: 47
    • Cmax: 0.194
    • Cmax_pos: 47
    • Smax: 0.268
    • Smax_pos: 45
    • Smean: 0.123
    • D: 0.131
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNSAKLIDHTLLKPESTRTQIDQIIDEAKAYHFKSVCVNPTHVKYAAERLADSEVLVCTVIGFPLGASTTATKAFETEDAIQNGADEIDMVINIGALKDGRFDDVQQDIEAVVKAAKGHTVKVIIETVLLDHDEIVKASELTKVAGADFVKTSTGFAGGGATAEDVKLMKDTVGADVEVKASGGVRNLEDFNKMVEAGATRIGASAGVQIMQGLEADSDY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CcpA
    CcpA (TF) important in Carbon catabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]