From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2129 [new locus tag: SACOL_RS11145 ]
  • pan locus tag?: SAUPAN005434000
  • symbol: deoC2
  • pan gene symbol?: deoC2
  • synonym:
  • product: deoxyribose-phosphate aldolase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2129 [new locus tag: SACOL_RS11145 ]
  • symbol: deoC2
  • product: deoxyribose-phosphate aldolase
  • replicon: chromosome
  • strand: -
  • coordinates: 2190464..2191126
  • length: 663
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATAGTGCAAAATTGATTGATCACACTTTATTGAAGCCTGAGTCAACACGTACGCAA
    ATCGATCAAATCATCGATGAAGCGAAAGCATACCATTTTAAATCTGTATGTGTGAATCCA
    ACGCATGTTAAATATGCAGCAGAGCGACTAGCTGATTCAGAGGTGTTAGTTTGTACGGTA
    ATAGGATTCCCATTAGGTGCATCGACAACTGCGACGAAAGCATTTGAAACAGAAGATGCG
    ATTCAAAATGGTGCAGATGAAATTGACATGGTCATCAACATCGGCGCATTAAAAGATGGA
    CGTTTTGATGATGTACAACAAGACATTGAAGCAGTGGTGAAAGCTGCGAAAGGTCACACA
    GTAAAAGTGATTATTGAGACGGTATTGTTGGACCATGACGAAATTGTAAAAGCGAGTGAA
    TTAACAAAAGCGGCTGGTGCGGACTTCGTTAAAACTTCAACAGGTTTTGCAGGTGGCGGT
    GCGACTGCAGAAGACGTTAAATTAATGAAAGATACAGTAGGTGCTGATATAGAAGTAAAA
    GCATCAGGTGGCGTACGTAATTTAGAAGATTTCAATAAAATGGTTGAAGCAGGTGCGACA
    CGTATTGGTGCGAGCGCAGGCGTTCAAATTATGCAAGGTTTAGAAGCAGATTCAGATTAC
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    663

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2129 [new locus tag: SACOL_RS11145 ]
  • symbol: DeoC2
  • description: deoxyribose-phosphate aldolase
  • length: 220
  • theoretical pI: 4.47623
  • theoretical MW: 23327.2
  • GRAVY: -0.0736364

Function[edit source | edit]

  • reaction:
    EC 4.1.2.4?  ExPASy
    Deoxyribose-phosphate aldolase2-deoxy-D-ribose 5-phosphate = D-glyceraldehyde 3-phosphate + acetaldehyde
  • TIGRFAM:
    MetabolismEnergy metabolismOtherdeoxyribose-phosphate aldolase (TIGR00126; EC 4.1.2.4; HMM-score: 287.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherdeoxyribose-phosphate aldolase (TIGR00126; EC 4.1.2.4; HMM-score: 287.6)
    predicted phospho-2-dehydro-3-deoxyheptonate aldolase (TIGR01949; EC 4.2.1.-; HMM-score: 19.2)
    MetabolismAmino acid biosynthesisHistidine familyimidazoleglycerol phosphate synthase, cyclase subunit (TIGR00735; HMM-score: 13.8)
    heme/flavin dehydrogenase, mycofactocin system (TIGR03966; EC 1.-.-.-; HMM-score: 8.7)
  • TheSEED:  
    CarbohydratesMonosaccharidesDeoxyribose and Deoxynucleoside Catabolism Deoxyribose-phosphate aldolase (EC 4.1.2.4) 
  • PFAM:
    TIM_barrel (CL0036) DeoC; DeoC/LacD family aldolase (PF01791; HMM-score: 93.2)
    His_biosynth; Histidine biosynthesis protein (PF00977; HMM-score: 17.1)
    G3P_antiterm; Glycerol-3-phosphate responsive antiterminator (PF04309; HMM-score: 16.8)
    AP_endonuc_2; Xylose isomerase-like TIM barrel (PF01261; HMM-score: 13.2)
    DHO_dh; Dihydroorotate dehydrogenase (PF01180; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.136
    • Ymax_pos: 47
    • Cmax: 0.194
    • Cmax_pos: 47
    • Smax: 0.268
    • Smax_pos: 45
    • Smean: 0.123
    • D: 0.131
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNSAKLIDHTLLKPESTRTQIDQIIDEAKAYHFKSVCVNPTHVKYAAERLADSEVLVCTVIGFPLGASTTATKAFETEDAIQNGADEIDMVINIGALKDGRFDDVQQDIEAVVKAAKGHTVKVIIETVLLDHDEIVKASELTKAAGADFVKTSTGFAGGGATAEDVKLMKDTVGADIEVKASGGVRNLEDFNKMVEAGATRIGASAGVQIMQGLEADSDY

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1]
    quantitative data / protein copy number per cell: 113 [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]