From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2115 [new locus tag: SA_RS12160 ]
  • pan locus tag?: SAUPAN005805000
  • symbol: SA2115
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2115 [new locus tag: SA_RS12160 ]
  • symbol: SA2115
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2378665..2379429
  • length: 765
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTTTTTAGATGAACACATTAATCGAAACTTTGATAAACTTAATGATAATGATTTACAT
    ATCGCTCACTTTATCAATACACATATAGATGAATGTAAAAATATGAAAATACAAGATTTA
    GCGCAATTCACACATGCCTCGAATGCAACCATTCACAGATTTACACGCAAATTAGGTTTT
    GACGGTTATAGTGATTTTAAATCGTACCTTAAATTTGAAAGTAATAAGACACACCAATTA
    CCTTCTAACTCTATCGATAGTTTCAAACAAGAAATCGATAGTACATTCAGTTATTTAGAA
    CGCGTTGATTACCAGCTTCTTACTGAAAAAATGCATACAGCTTCAACAATATATTTGTAT
    GGTACAGGGCGTGCACAGTTAAACGTTGCTTCAGAGGCACAGCGTATATTGTTAACGTTA
    CATAATCATGTCATTGTACTTCATGATGAACATGAACTTAAAATGATTTTGAACAAGAGT
    GAACCTAATGATTTATTCTTTATTATTTCATTATCAGGTGAAACACATGAATTATTAGAA
    GTAACAAACTTGCTTCAACTTAGACAAAAATACTTTATTTCTGTTACTACAATGAAAGAT
    AATACCCTTGCTCAAAAAGCAAATTACAACGTCTATGTATCCAGTAACACATTCTACTTA
    ACTGATGGTACAGACTATTCTAGCTTCATCAGTTATCATATATTCTTTGAAACACTTGTA
    AGAAAATATAATGAGTATTTACTACATAATGATATTTCAAATTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    765

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2115 [new locus tag: SA_RS12160 ]
  • symbol: SA2115
  • description: hypothetical protein
  • length: 254
  • theoretical pI: 6.33997
  • theoretical MW: 29785.2
  • GRAVY: -0.422047

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    6-phospho 3-hexuloisomerase (TIGR03127; EC 5.3.-.-; HMM-score: 47.6)
    MetabolismEnergy metabolismSugarssugar isomerase, KpsF/GutQ family (TIGR00393; HMM-score: 26.3)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanglutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 19.6)
    MetabolismCentral intermediary metabolismAmino sugarsglutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 19.6)
    bifunctional phosphoglucose/phosphomannose isomerase (TIGR02128; EC 5.3.1.9; HMM-score: 13.1)
  • TheSEED:  
    Transcriptional regulator, RpiR family 
  • PFAM:
    HTH (CL0123) HTH_6; Helix-turn-helix domain, rpiR family (PF01418; HMM-score: 64.3)
    SIS (CL0067) SIS; SIS domain (PF01380; HMM-score: 60.6)
    SIS_2; SIS domain (PF13580; HMM-score: 14.8)
    HTH (CL0123) HTH_IclR; IclR helix-turn-helix domain (PF09339; HMM-score: 14.3)
    no clan definedDUF4065; Protein of unknown function (DUF4065) (PF13274; HMM-score: 13.2)
    HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.095
    • Ymax_pos: 47
    • Cmax: 0.106
    • Cmax_pos: 42
    • Smax: 0.111
    • Smax_pos: 40
    • Smean: 0.078
    • D: 0.088
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MFLDEHINRNFDKLNDNDLHIAHFINTHIDECKNMKIQDLAQFTHASNATIHRFTRKLGFDGYSDFKSYLKFESNKTHQLPSNSIDSFKQEIDSTFSYLERVDYQLLTEKMHTASTIYLYGTGRAQLNVASEAQRILLTLHNHVIVLHDEHELKMILNKSEPNDLFFIISLSGETHELLEVTNLLQLRQKYFISVTTMKDNTLAQKANYNVYVSSNTFYLTDGTDYSSFISYHIFFETLVRKYNEYLLHNDISN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA2115 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CcpA
    CcpA (TF) important in Carbon catabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]