From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2406 [new locus tag: SA_RS13765 ]
  • pan locus tag?: SAUPAN006314000
  • symbol: gbsA
  • pan gene symbol?: betB
  • synonym:
  • product: glycine betaine aldehyde dehydrogenase gbsA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2406 [new locus tag: SA_RS13765 ]
  • symbol: gbsA
  • product: glycine betaine aldehyde dehydrogenase gbsA
  • replicon: chromosome
  • strand: -
  • coordinates: 2696247..2697737
  • length: 1491
  • essential: yes DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGGAACTTTTAAAACATTTATCTCAGCGTCAATATATTGATGGTGAGTGGGTTGAAAGC
    ACGAATAAAAATACAAGAGATATTATCAATCCTTACAATCAAGAAGTGATATTTACGGTT
    TCTGAAGGGACAAAAGAGGATGCAGAACGTGCAATCTTAGCTGCAAGACGTGCGTTTGAG
    TCTGGTGAATGGTCGCAAGAAACTGCTGAAAAAAGAGGTAAAAAAGTACGTGCCATCGCG
    GACAAGATCAAAGAACATCGCGAAGCGTTAGCACGATTAGAAACATTAGATACTGGAAAA
    ACGTTAGAAGAATCATATGCAGATATGGATGATATTCATAATGTGTTTATGTATTTTGCT
    GGATTAGCAGATAAAGATGGTGGCGAAATGATTGATTCACCAATTCCAGATACAGAAAGC
    AAAATTGTTAAAGAACCAGTAGGTGTAGTTACACAAATTACACCTTGGAATTATCCGTTA
    TTACAAGCATCATGGAAAATTGCGCCAGCGCTTGCTACGGGTTGTTCACTAGTTATGAAA
    CCAAGTGAAATTACACCATTAACAACAATACGTGTTTTTGAATTAATGGAAGAAGTTGGT
    TTCCCTAAAGGAACAATTAATCTTATTCTAGGTGCAGGTTCTGAAGTTGGTGACGTAATG
    TCAGGTCATAAAGAGGTTGACCTTGTATCATTTACAGGTGGCATTGAGACTGGTAAGCAT
    ATTATGAAAAATGCTGCTAATAATGTTACGAATATTGCCTTGGAACTTGGCGGTAAAAAT
    CCAAACATTATCTTTGATGATGCTGATTTTGAATTGGCAGTAGACCAAGCGTTAAATGGT
    GGATATTTTCATGCAGGTCAAGTTTGTTCAGCAGGATCAAGAATATTAGTACAAAACAGT
    ATTAAAGACAAATTTGAGCAAGCACTTATTGATCGCGTGAAAAAAATCAAATTAGGTAAT
    GGTTTTGATGCTGATACTGAAATGGGACCAGTGATTTCAACAGAACATCGTAATAAGATC
    GAATCTTATATGGATGTAGCTAAAGCAGAAGGCGCAACAATTGCTGTTGGTGGTAAACGT
    CCAGATAGAGACGATTTAAAAGATGGTCTATTCTTCGAGCCAACAGTCATTACAAATTGT
    GATACGTCAATGCGTATTGTACAAGAAGAGGTTTTCGGACCTGTCGTTACTGTAGAAGGC
    TTTGAAACTGAACAAGAAGCGATTCAATTAGCGAATGATTCTATATATGGTTTAGCAGGT
    GCTGTATTTTCTAAAGATATTGGAAAAGCACAACGCGTTGCTAACAAGTTGAAACTTGGA
    ACGGTGTGGATTAATGATTTCCATCCATATTTTGCACAAGCGCCATGGGGTGGATACAAA
    CAATCAGGTATCGGTAGAGAATTAGGCAAAGAAGGCTTAGAAGAGTACCTTGTTTCAAAA
    CACATTTTAACAAATACAAATCCACAATTAGTGAATTGGTTTAGCAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1491

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2406 [new locus tag: SA_RS13765 ]
  • symbol: GbsA
  • description: glycine betaine aldehyde dehydrogenase gbsA
  • length: 496
  • theoretical pI: 4.7412
  • theoretical MW: 54679.5
  • GRAVY: -0.31754

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesAdaptations to atypical conditionsbetaine-aldehyde dehydrogenase (TIGR01804; EC 1.2.1.8; HMM-score: 776.2)
    5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase (TIGR02299; EC 1.2.1.60; HMM-score: 483.9)
    MetabolismEnergy metabolismOther2-hydroxymuconic semialdehyde dehydrogenase (TIGR03216; EC 1.2.1.-; HMM-score: 432.3)
    MetabolismCentral intermediary metabolismOthersuccinate-semialdehyde dehydrogenase (TIGR01780; EC 1.2.1.-; HMM-score: 407.2)
    1-pyrroline dehydrogenase (TIGR03374; EC 1.2.1.19; HMM-score: 400)
    Unknown functionEnzymes of unknown specificityaldehyde dehydrogenase, Rv0768 family (TIGR04284; EC 1.2.1.-; HMM-score: 384.4)
    MetabolismEnergy metabolismAmino acids and aminesputative delta-1-pyrroline-5-carboxylate dehydrogenase (TIGR01237; EC 1.2.1.88; HMM-score: 313.1)
    putative phosphonoacetaldehyde dehydrogenase (TIGR03250; EC 1.2.1.-; HMM-score: 299.9)
    MetabolismEnergy metabolismAmino acids and aminesmethylmalonate-semialdehyde dehydrogenase (acylating) (TIGR01722; EC 1.2.1.27; HMM-score: 284.4)
    MetabolismEnergy metabolismAmino acids and aminessuccinylglutamate-semialdehyde dehydrogenase (TIGR03240; EC 1.2.1.71; HMM-score: 237.5)
    MetabolismEnergy metabolismAmino acids and aminesdelta-1-pyrroline-5-carboxylate dehydrogenase (TIGR01238; EC 1.2.1.88; HMM-score: 212.4)
    MetabolismEnergy metabolismAmino acids and amines1-pyrroline-5-carboxylate dehydrogenase (TIGR01236; EC 1.2.1.88; HMM-score: 195)
    phenylacetic acid degradation protein paaN (TIGR02278; HMM-score: 156.7)
    acetaldehyde dehydrogenase (acetylating) (TIGR02518; EC 1.2.1.10; HMM-score: 51.6)
    phenylacetic acid degradation protein paaN (TIGR02288; HMM-score: 41.2)
  • TheSEED:  
    Stress ResponseOsmotic stressCholine and Betaine Uptake and Betaine Biosynthesis Betaine aldehyde dehydrogenase (EC 1.2.1.8) 
  • PFAM:
    ALDH-like (CL0099) Aldedh; Aldehyde dehydrogenase family (PF00171; HMM-score: 584.4)
    T3SS-Chaperone (CL0419) YscO-like; YscO-like protein (PF16789; HMM-score: 17.4)
    ALDH-like (CL0099) DUF1487; Protein of unknown function (DUF1487) (PF07368; HMM-score: 15.7)
    no clan definedSART-1; SART-1 family (PF03343; HMM-score: 14.1)
    DUF1465; Protein of unknown function (DUF1465) (PF07323; HMM-score: 12.5)
    Hybrid (CL0105) GARS_C; Phosphoribosylglycinamide synthetase, C domain (PF02843; HMM-score: 12.3)
    TPR (CL0020) RPN7; 26S proteasome subunit RPN7 (PF10602; HMM-score: 12)
    no clan definedRPEL; RPEL repeat (PF02755; HMM-score: 10.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 21
    • Cmax: 0.107
    • Cmax_pos: 51
    • Smax: 0.162
    • Smax_pos: 17
    • Smean: 0.11
    • D: 0.112
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15928199 NCBI
  • RefSeq: NP_375732 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MELLKHLSQRQYIDGEWVESTNKNTRDIINPYNQEVIFTVSEGTKEDAERAILAARRAFESGEWSQETAEKRGKKVRAIADKIKEHREALARLETLDTGKTLEESYADMDDIHNVFMYFAGLADKDGGEMIDSPIPDTESKIVKEPVGVVTQITPWNYPLLQASWKIAPALATGCSLVMKPSEITPLTTIRVFELMEEVGFPKGTINLILGAGSEVGDVMSGHKEVDLVSFTGGIETGKHIMKNAANNVTNIALELGGKNPNIIFDDADFELAVDQALNGGYFHAGQVCSAGSRILVQNSIKDKFEQALIDRVKKIKLGNGFDADTEMGPVISTEHRNKIESYMDVAKAEGATIAVGGKRPDRDDLKDGLFFEPTVITNCDTSMRIVQEEVFGPVVTVEGFETEQEAIQLANDSIYGLAGAVFSKDIGKAQRVANKLKLGTVWINDFHPYFAQAPWGGYKQSGIGRELGKEGLEEYLVSKHILTNTNPQLVNWFSK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]