From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2418 [new locus tag: SA_RS13865 ]
  • pan locus tag?: SAUPAN006338000
  • symbol: SA2418
  • pan gene symbol?: nsaR
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2418 [new locus tag: SA_RS13865 ]
  • symbol: SA2418
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2713922..2714587
  • length: 666
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAAAATATTAATTGTTGAAGATGATTTTGTTATAGCAGAAAGTTTAGCATCTGAACTT
    AAAAAATGGAATTACGGTGTTATTGTCGTTGAACAATTTGATGATATACTGTCTATCTTT
    AACCAACATCAACCTCAGCTTGTATTGCTAGATATTAATTTGCCAACGTTAAATGGTTTT
    CATTGGTGTCAAGAAATCCGAAAAACATCTAATGTGCCAATTATATTTATTAGTTCCCGT
    ATTGATAATATGGACCAAATTATGGCAATACAAATGGGGGGAGATGATTTTATCGAAAAG
    CCATTTAACTTGTCATTAACGATTGCCAAAATTCAAGCATTATTGAGACGAACTTATGAC
    TTGTCAGTAGCTAATGATTCATTGACGGTTAAAGGTTGTACATTAATATTAGATGAAGCA
    AAAGTCGTGTATCAAGAACAAAACATACAGCTATCTTTGACTGAATTACAAATATTAAAG
    TTATTATTTCAAAATGAAGATAAATATGTAAGTAGAACTGCTTTAATTGAAAAATGTTGG
    GAATCAGAAAACTTCATAGATGATAACACATTAGCTGTTAACATGACGCGCCTGCGTAAA
    AAATTAAATACTATTGGCGTTAATGATTTTATCATTACAAAGAAAAATGTCGGATATAAA
    GTATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    666

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2418 [new locus tag: SA_RS13865 ]
  • symbol: SA2418
  • description: hypothetical protein
  • length: 221
  • theoretical pI: 4.79634
  • theoretical MW: 25415.3
  • GRAVY: 0.0171946

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 159.5)
    Signal transductionSignal transductionTwo-component systemsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 159.5)
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 119.6)
    Signal transductionRegulatory functionsDNA interactionsheavy metal response regulator (TIGR01387; HMM-score: 115)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 50.2)
    Signal transductionRegulatory functionsDNA interactionsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 50.2)
    Signal transductionSignal transductionTwo-component systemsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 50.2)
    Signal transductionRegulatory functionsDNA interactionsPEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 40.9)
    Cellular processesCellular processesSporulation and germinationsporulation transcription factor Spo0A (TIGR02875; HMM-score: 39.3)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 34.2)
  • TheSEED:  
    Bacitracin Stress Response ABC transporter-like sensor linked response regulator SAV2625 
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 83.8)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 72.6)
    HTH_11; HTH domain (PF08279; HMM-score: 11)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.095
    • Ymax_pos: 27
    • Cmax: 0.108
    • Cmax_pos: 27
    • Smax: 0.102
    • Smax_pos: 67
    • Smean: 0.077
    • D: 0.088
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKILIVEDDFVIAESLASELKKWNYGVIVVEQFDDILSIFNQHQPQLVLLDINLPTLNGFHWCQEIRKTSNVPIIFISSRIDNMDQIMAIQMGGDDFIEKPFNLSLTIAKIQALLRRTYDLSVANDSLTVKGCTLILDEAKVVYQEQNIQLSLTELQILKLLFQNEDKYVSRTALIEKCWESENFIDDNTLAVNMTRLRKKLNTIGVNDFIITKKNVGYKV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]