From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0341 [new locus tag: SACOL_RS01715 ]
  • pan locus tag?: SAUPAN001444000
  • symbol: SACOL0341
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0341 [new locus tag: SACOL_RS01715 ]
  • symbol: SACOL0341
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 364751..365551
  • length: 801
  • essential: unknown

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGGAGAAGTATCGTGGATAAAACTTAAAGTTGGCATGTTTGATGACAGCAAAATCAAA
    TATATCGAAGCTTTACCCGAAAGAGATACGATCATAACTATTTGGGTTAAGTTGCTAACT
    TTATCAGGAAAGTACAATGAACAAGGTTATATTATGCTATCCGAAAACTTGCCGTACAAC
    GAAGAAATGTTAGCAAATGAATTTAATAGACCTATTAACTCAATAAGGTTAGCAATTCAA
    ACTTTTGAGACATTGGGCATGATTGAAAAAGTTAATGGTGTCATAAAAGTGACAAACTGG
    GAGAAGCATCAAAGCTTAGATAGCAAAGCTAAGCATAAAGAAAAAAATAAATTGCGACAA
    CAACGCTATCGAGAGAGACAGAAAAAGTTACTAGAAGCAAAACGTAACGTTACCGTAACG
    TTACGTAACGATACAGAAGAAGAAAGAGAAGAAGAAAAAGAAGAAGAATATAAGAATAAA
    GAAGAAGAAAGAGAAGCCGTCTTCTCATCTTCAATAAAATATATAATTGCAAATTTGGAT
    GATAAGTTAACGCCTAATCAAATGGAGCAATTAGGGTTTGCTATTGATGATATAGGTACG
    AACGCTTTTGAAGTTGTAAAAGTAGGTGTTGAGTACACTAAAAGCAAAAGTGCGCATGGT
    GGCTACTTAATTAAAGTTTTGAACAACTGGGCTAAAGAGAATGTCAAAACAAAAGAAGAT
    GCAGAACACAAAATAGCGCCTAGGAAAAACACAACTGATGATGTCATTGCGCAAATGGAA
    AAAGAATTGAGTGATGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0341 [new locus tag: SACOL_RS01715 ]
  • symbol: SACOL0341
  • description: hypothetical protein
  • length: 266
  • theoretical pI: 5.57701
  • theoretical MW: 30991
  • GRAVY: -0.817293

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsphage replisome organizer, putative, N-terminal region (TIGR01714; HMM-score: 177.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaD domain protein (TIGR01446; HMM-score: 62.3)
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsDnaD domain protein (TIGR01446; HMM-score: 62.3)
    MetabolismEnergy metabolismSugarsL-fucose isomerase (TIGR01089; EC 5.3.1.25; HMM-score: 12.2)
  • TheSEED:  
    Phage replication initiation 
  • PFAM:
    HTH (CL0123) Phage_rep_org_N; N-terminal phage replisome organiser (Phage_rep_org_N) (PF09681; HMM-score: 161.2)
    no clan definedDnaB_2; Replication initiation and membrane attachment (PF07261; HMM-score: 44.1)
    ssDNA-exonuc_C; Single-strand DNA-specific exonuclease, C terminal domain (PF10141; HMM-score: 14.7)
    CSRNP_N; Cysteine/serine-rich nuclear protein N-terminus (PF16019; HMM-score: 12.5)
    Peptidase_AD (CL0130) Presenilin; Presenilin (PF01080; HMM-score: 8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.1
    • Ymax_pos: 70
    • Cmax: 0.111
    • Cmax_pos: 54
    • Smax: 0.115
    • Smax_pos: 64
    • Smean: 0.07
    • D: 0.088
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MGEVSWIKLKVGMFDDSKIKYIEALPERDTIITIWVKLLTLSGKYNEQGYIMLSENLPYNEEMLANEFNRPINSIRLAIQTFETLGMIEKVNGVIKVTNWEKHQSLDSKAKHKEKNKLRQQRYRERQKKLLEAKRNVTVTLRNDTEEEREEEKEEEYKNKEEEREAVFSSSIKYIIANLDDKLTPNQMEQLGFAIDDIGTNAFEVVKVGVEYTKSKSAHGGYLIKVLNNWAKENVKTKEDAEHKIAPRKNTTDDVIAQMEKELSDD

Experimental data[edit source | edit]

  • experimental localization: Cytoplasmic [1] [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]