From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0504 [new locus tag: SACOL_RS02545 ]
  • pan locus tag?: SAUPAN002176000
  • symbol: SACOL0504
  • pan gene symbol?: metN2
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0504 [new locus tag: SACOL_RS02545 ]
  • symbol: SACOL0504
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 505036..506061
  • length: 1026
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGATTGAGTTTCGACAGGTAAGTAAGACCTTTAATAAAAAGAAGCAAAAAATAGATGCT
    TTGAAGGACGTATCATTTACGGTCAATCGCAATGATATTTTTGGTGTGATTGGATATAGT
    GGTGCAGGAAAAAGTACGTTGGTAAGACTCGTGAATCATCTTGAAGCTGCCTCGAATGGA
    CAAGTGATTGTAGATGGACATGATATTACGAATTATAGCGATAAAATGATGAGGGATATT
    AAGAAAGATATCGGTATGATATTTCAGCATTTCAATTTATTAAATTCAGCTACCGTATTT
    AAAAATGTAGCAATGCCACTCATTTTAAGTAAGAAAAGCAAAACAGAAATTAAGCAACGA
    GTAACGGAAATGCTTGAATTTGTAGGATTGAGTGATAAAAAAGACCAATTTCCTGATGAA
    TTATCTGGTGGGCAGAAGCAAAGGGTGGCTATTGCAAGAGCGCTTGTTACTAATCCGAAA
    ATACTCCTATGCGATGAAGCAACAAGCGCATTGGATCCAGCAACGACTGCTTCGATATTG
    ACGTTATTAAAGAATGTCAATCAAACCTTTGGCATTACAATTATGATGATTACACATGAA
    ATGCGCGTTATTAAAGACATTTGTAATCGTGTTGCTGTAATGGAAAAGGGGAAAGTGGTT
    GAAACAGGAACTGTTAAAGAGGTGTTTAGTCATCCTAAAACGACGATTGCTCAAAATTTT
    GTGTCTACAGTTATACAGACTGAGCCAAGTACATCATTGATTCGTCGATTGAATGACGAA
    CAAGTTGGCGATTTTAAAGATTATAAAATCTTCGTCGAGGAAACTCAGGTGACACAACCG
    ATTATAAATGACTTGATTCAAATTTGTGGCAGAGAGGTTAAAATTTTATTTTCATCTATG
    TCAGAAATACAAGGTAACACCGTATGTTATATGTGGCTTCGATTTAATATGGATCAACAA
    TTTGAAGACACGGCAATAAATCAATATTTCAAAGAGAAAAATATTCAATTTGAGGAGGTG
    CATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1026

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0504 [new locus tag: SACOL_RS02545 ]
  • symbol: SACOL0504
  • description: ABC transporter ATP-binding protein
  • length: 341
  • theoretical pI: 8.31235
  • theoretical MW: 38675.5
  • GRAVY: -0.198827

Function[edit source | edit]

  • reaction:
    EC 3.6.3.-?  ExPASy
  • TIGRFAM:
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 375.9)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 227)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 216.3)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 211.7)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 207.5)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 207.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 206.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 204.7)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 200.7)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 195.6)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 194.7)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 191.7)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 190.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 188.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 180.5)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 176.4)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 174.2)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 174.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 165.6)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 154.7)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 152.7)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 149.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 149.4)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 147.8)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 145.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 145.7)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 142.3)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 142.3)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 140)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 136.5)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 135.6)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 135.3)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 135.3)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 134.3)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 130.7)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 130.7)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 128.6)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 127.8)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 126.2)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 117.6)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 114.1)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 114.1)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 112.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 110.9)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 110.4)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 109.6)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 105.5)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 105.2)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 105.2)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 105.2)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 101.5)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 101.1)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 95.3)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 94.7)
    MetabolismTransport and binding proteinsOtherrim ABC transporter (TIGR01257; HMM-score: 92.7)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 90.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 85)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 85)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 82.7)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 75.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 68.4)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 59.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 56.7)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 56.7)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 55.5)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 42.2)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 34.8)
  • TheSEED:  
    Amino Acids and DerivativesLysine, threonine, methionine, and cysteineMethionine Biosynthesis Methionine ABC transporter ATP-binding protein 
    Lysine, threonine, methionine, and cysteineMethionine Degradation Methionine ABC transporter ATP-binding protein 
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.8)
    ACT (CL0070) NIL; NIL domain (PF09383; HMM-score: 40.2)
    P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 26.2)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 25)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 21.6)
    AAA_22; AAA domain (PF13401; HMM-score: 21.4)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.7)
    no clan definedDUF3652; Huntingtin protein region (PF12372; HMM-score: 16.6)
    P-loop_NTPase (CL0023) AAA_30; AAA domain (PF13604; HMM-score: 16.3)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.8)
    AAA_23; AAA domain (PF13476; HMM-score: 15)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 14.5)
    AAA_18; AAA domain (PF13238; HMM-score: 14.5)
    no clan definedDUF99; Protein of unknown function DUF99 (PF01949; HMM-score: 13.4)
    P-loop_NTPase (CL0023) SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 13.1)
    AAA_17; AAA domain (PF13207; HMM-score: 13.1)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 12.9)
    AAA_33; AAA domain (PF13671; HMM-score: 12.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1571(accC)acetyl-CoA carboxylase biotin carboxylase subunit  [1] (data from MRSA252)
    SACOL1215(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    SACOL1636(dnaJ)chaperone protein DnaJ  [1] (data from MRSA252)
    SACOL0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL1961(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1837(metK)S-adenosylmethionine synthetase  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL2561hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.164
    • Ymax_pos: 15
    • Cmax: 0.166
    • Cmax_pos: 57
    • Smax: 0.32
    • Smax_pos: 5
    • Smean: 0.265
    • D: 0.204
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MIEFRQVSKTFNKKKQKIDALKDVSFTVNRNDIFGVIGYSGAGKSTLVRLVNHLEAASNGQVIVDGHDITNYSDKMMRDIKKDIGMIFQHFNLLNSATVFKNVAMPLILSKKSKTEIKQRVTEMLEFVGLSDKKDQFPDELSGGQKQRVAIARALVTNPKILLCDEATSALDPATTASILTLLKNVNQTFGITIMMITHEMRVIKDICNRVAVMEKGKVVETGTVKEVFSHPKTTIAQNFVSTVIQTEPSTSLIRRLNDEQVGDFKDYKIFVEETQVTQPIINDLIQICGREVKILFSSMSEIQGNTVCYMWLRFNMDQQFEDTAINQYFKEKNIQFEEVH

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SACOL1681 (CymR*)
    CymR* (TF) important in Cysteine metabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]