From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1145 [new locus tag: SACOL_RS05845 ]
  • pan locus tag?: SAUPAN003367000
  • symbol: srtB
  • pan gene symbol?: srtB
  • synonym:
  • product: sortase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1145 [new locus tag: SACOL_RS05845 ]
  • symbol: srtB
  • product: sortase
  • replicon: chromosome
  • strand: +
  • coordinates: 1152964..1153698
  • length: 735
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAGAATGAAGCGATTTTTAACTATTGTACAAATTTTATTGGTTGTAATTATTATCATT
    TTTGGTTACAAAATTGTTCAAACATATATTGAAGACAAGCAAGAACGCGCAAATTATGAG
    AAATTACAACAAAAATTTCAAATGCTGATGAGCAAACATCAAGAACATGTGAGACCACAA
    TTTGAATCACTTGAAAAAATAAATAAAGACATTGTTGGATGGATAAAATTATCAGGAACA
    TCATTAAATTATCCAGTACTACAAGGTAAGACAAATCACGATTATTTAAATTTAGATTTT
    GAGCGAGAACATCGACGTAAAGGTAGTATTTTTATGGATTTTAGAAATGAATTGAAGAAT
    TTAAATCATAATACTATTTTATACGGGCACCATGTCGGTGATAATACGATGTTTGATGTG
    TTAGAAGATTATTTAAAGCAATCGTTTTATGAAAAACACAAGATAATTGAATTTGACAAT
    AAATATGGTAAATATCAATTGCAAGTATTTAGTGCATATAAAACTACTACTAAAGATAAT
    TACATACGTACAGATTTTGAAAATGATCAAGATTATCAACAATTTTTAGATGAGACAAAA
    CGTAAATCTGTAATTAATTCAGATGTTAATGTAACGGTAAAAGATAGAATAATGACTTTA
    TCAACGTGCGAAGATGCATATAGTGAAACGACGAAAAGAATTGTTGTTGTCGCAAAAATA
    ATTAAGGTAAGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    735

Protein[edit source | edit]

Protein Data Bank: 4LFD

General[edit source | edit]

  • locus tag: SACOL1145 [new locus tag: SACOL_RS05845 ]
  • symbol: SrtB
  • description: sortase
  • length: 244
  • theoretical pI: 9.23648
  • theoretical MW: 29163.2
  • GRAVY: -0.582787

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeOthersortase, SrtB family (TIGR03064; EC 3.4.22.71; HMM-score: 304.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsortase, SrtB family (TIGR03064; EC 3.4.22.71; HMM-score: 304.4)
    Cell structureCell envelopeOthersortase (TIGR01076; EC 3.4.22.-; HMM-score: 10.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsortase (TIGR01076; EC 3.4.22.-; HMM-score: 10.4)
  • TheSEED:  
    Cell Wall and CapsuleGram-Positive cell wall componentsSortase NPQTN specific sortase B 
    Iron acquisition and metabolismIron acquisition and metabolism - no subcategoryHeme, hemin uptake and utilization systems in GramPositives NPQTN specific sortase B 
  • PFAM:
    no clan definedSortase; Sortase family (PF04203; HMM-score: 87)
    TPR (CL0020) TPR_21; Tetratricopeptide repeat-like domain (PF09976; HMM-score: 13.8)
    C_Lectin (CL0056) Ly49; Ly49-like protein, N-terminal region (PF08391; HMM-score: 10.5)
    no clan definedHJURP_C; Holliday junction regulator protein family C-terminal repeat (PF12347; HMM-score: 10.3)
    Arc_PepC_II; Archaeal Peptidase A24 C-terminus Type II (PF06847; HMM-score: 9.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0
    • N-terminally Anchored Score: 4
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.197
    • Ymax_pos: 11
    • Cmax: 0.169
    • Cmax_pos: 29
    • Smax: 0.509
    • Smax_pos: 1
    • Smean: 0.368
    • D: 0.264
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MRMKRFLTIVQILLVVIIIIFGYKIVQTYIEDKQERANYEKLQQKFQMLMSKHQEHVRPQFESLEKINKDIVGWIKLSGTSLNYPVLQGKTNHDYLNLDFEREHRRKGSIFMDFRNELKNLNHNTILYGHHVGDNTMFDVLEDYLKQSFYEKHKIIEFDNKYGKYQLQVFSAYKTTTKDNYIRTDFENDQDYQQFLDETKRKSVINSDVNVTVKDRIMTLSTCEDAYSETTKRIVVVAKIIKVS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SACOL1541 (Fur*)
    Fur* (TF) important in Iron homeostasis  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]