From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1240 [new locus tag: SACOL_RS06340 ]
  • pan locus tag?: SAUPAN003509000
  • symbol: SACOL1240
  • pan gene symbol?: fakA
  • synonym:
  • product: DAK2 domain-containing protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1240 [new locus tag: SACOL_RS06340 ]
  • symbol: SACOL1240
  • product: DAK2 domain-containing protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1247760..1249406
  • length: 1647
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    ATGATTAGCAAAATTAATGGTAAATTATTTGCCGATATGATTATACAAGGGGCACAAAAT
    TTATCTAACAATGCAGATTTGGTAGATTCTTTGAATGTGTATCCAGTGCCAGATGGTGAT
    ACAGGAACAAATATGAATCTTACTATGACTTCAGGTCGCGAAGAAGTAGAGAATAATTTG
    TCGAAAAATATCGGCGAATTAGGTAAAACATTCTCGAAAGGTTTACTAATGGGTGCAAGA
    GGTAACTCTGGTGTCATCTTGTCACAATTATTCAGAGGATTTTGTAAAAATATTGAAAGT
    GAATCTGAAATTAATTCAAAATTGTTAGCTGAAAGTTTTCAAGCTGGTGTTGAAACGGCA
    TATAAAGCTGTTATGAAACCAGTTGAAGGTACAATACTTACAGTTGCAAAAGATGCTGCG
    CAAGCTGCAATAGAAAAAGCAAATAATACTGAAGATTGTATAGAATTAATGGAGTACATT
    ATTGTAAAAGCCAATGAATCACTTGAAAACACACCAAACTTATTAGCTGTACTTAAAGAA
    GTTGGTGTTGTTGATAGTGGCGGTAAAGGTTTGTTATGCGTTTACGAAGGATTCTTAAAA
    GCGCTTAAAGGTGAAAAAGTTGAAGCCAAAGTTGCAAAGATAGATAAAGATGAATTTGTA
    CATGATGAACATGATTTCCATGGTGTAATTAATACTGAAGATATTATTTATGGCTATTGT
    ACTGAAATGATGGTTCGTTTTGGAAAGAATAAAAAAGCCTTTGATGAACAAGAATTCAGG
    CAAGATATGAGTCAATTTGGTGATTCTTTATTAGTCATTAATGATGAAGAAATTGTGAAA
    GTTCACGTGCATACCGAATACCCAGGTAAAGTGTTTAATTATGGTCAACAATATGGTGAA
    TTAATTAAACTTAAGGTTGAAAATATGAGAGAACAGCACCGTGAAGTGATTCGAAAAGAA
    CAGCACACAGCTAAACCGAAAATGGAAACGGTTGAAACAGCAATTATTACTATTTCTATG
    GGTGAAGGTATTTCAGAGATATTTAAATCAATGGGTGCCACACATATCATTAGTGGTGGA
    CAAACGATGAATCCTTCTACAGAAGATATCGTTAAAGTCATTGAACAATCAAAATGTAAA
    CGTGCAATTATTTTACCGAATAATAAAAATATCTTAATGGCAAGTGAACAAGCAGCGAGT
    ATTGTTGATGCAGAAGCTGTTGTTATTCCAACGAAATCTATTCCTCAAGGTATAAGCGCA
    CTATTCCAATATGATGTGGACGCAACACTTGAAGAAAATAAAGCGCAAATGGCTGATTCA
    GTAAATAACGTTAAATCTGGTTCATTAACGTACGCTGTTCGTGATACGAAAATTGATGGC
    GTTGAGATTAAAAAAGACGCGTTTATGGGCTTGATTGAAGATAAGATTGTAAGCAGCCAA
    AGTGATCAATTAACAACGGTTACTGAGTTGTTAAATGAGATGTTAGCAGAAGATAGTGAA
    ATATTGACTGTGATTATTGGTCAAGATGCAGAGCAAGCAGTTACAGATAACATGATAAAC
    TGGATCGAAGAGCAATATCCAGATGTAGAAGTGGAAGTTCATGAAGGTGGACAACCAATT
    TATCAATATTTCTTTTCAGTAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1647

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1240 [new locus tag: SACOL_RS06340 ]
  • symbol: SACOL1240
  • description: DAK2 domain-containing protein
  • length: 548
  • theoretical pI: 4.3893
  • theoretical MW: 60515.3
  • GRAVY: -0.240146

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    DAK2 domain fusion protein YloV (TIGR03599; HMM-score: 699)
    dihydroxyacetone kinase, L subunit (TIGR02365; EC 2.7.-.-; HMM-score: 38.1)
    dihydroxyacetone kinase (TIGR02361; EC 2.7.1.29; HMM-score: 21)
  • TheSEED:  
    A Gram-positive cluster that relates ribosomal protein L28P to a set of uncharacterized proteins Dihydroxyacetone kinase-like protein, phosphatase domain / Dihydroxyacetone kinase-like protein, kinase domain 
    Glycerolipid and Glycerophospholipid Metabolism in Bacteria Dihydroxyacetone kinase-like protein, phosphatase domain / Dihydroxyacetone kinase-like protein, kinase domain 
  • PFAM:
    EDD (CL0245) Dak1_2; Dihydroxyacetone kinase family (PF13684; HMM-score: 399.4)
    no clan definedDak2; DAK2 domain (PF02734; HMM-score: 138.7)
    DUF2574; Protein of unknown function (DUF2574) (PF10836; HMM-score: 12.2)
    Hybrid (CL0105) GCV_H; Glycine cleavage H-protein (PF01597; HMM-score: 11.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.196
    • Ymax_pos: 28
    • Cmax: 0.134
    • Cmax_pos: 28
    • Smax: 0.527
    • Smax_pos: 17
    • Smean: 0.257
    • D: 0.22
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MISKINGKLFADMIIQGAQNLSNNADLVDSLNVYPVPDGDTGTNMNLTMTSGREEVENNLSKNIGELGKTFSKGLLMGARGNSGVILSQLFRGFCKNIESESEINSKLLAESFQAGVETAYKAVMKPVEGTILTVAKDAAQAAIEKANNTEDCIELMEYIIVKANESLENTPNLLAVLKEVGVVDSGGKGLLCVYEGFLKALKGEKVEAKVAKIDKDEFVHDEHDFHGVINTEDIIYGYCTEMMVRFGKNKKAFDEQEFRQDMSQFGDSLLVINDEEIVKVHVHTEYPGKVFNYGQQYGELIKLKVENMREQHREVIRKEQHTAKPKMETVETAIITISMGEGISEIFKSMGATHIISGGQTMNPSTEDIVKVIEQSKCKRAIILPNNKNILMASEQAASIVDAEAVVIPTKSIPQGISALFQYDVDATLEENKAQMADSVNNVKSGSLTYAVRDTKIDGVEIKKDAFMGLIEDKIVSSQSDQLTTVTELLNEMLAEDSEILTVIIGQDAEQAVTDNMINWIEEQYPDVEVEVHEGGQPIYQYFFSVE

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3] [4]
    quantitative data / protein copy number per cell: 973 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]