From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1451 [new locus tag: SACOL_RS07400 ]
  • pan locus tag?: SAUPAN003835000
  • symbol: arlR
  • pan gene symbol?: arlR
  • synonym:
  • product: DNA-binding response regulator ArlR

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1451 [new locus tag: SACOL_RS07400 ]
  • symbol: arlR
  • product: DNA-binding response regulator ArlR
  • replicon: chromosome
  • strand: -
  • coordinates: 1465407..1466066
  • length: 660
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGCAAATTTTAATAGTAGAAGATGAACAAAACTTAGCAAGATTTCTTGAATTGGAA
    CTCACACATGAAAATTACAATGTGGACACAGAGTATGATGGACAAGACGGTTTAGATAAA
    GCGCTTAGCCATTACTATGATTTAATCATATTAGATTTAATGTTGCCGTCAATTAATGGC
    TTAGAAATTTGTCGCAAAATTAGACAACAACAATCTACACCTATCATTATAATTACAGCG
    AAAAGTGATACGTATGACAAAGTTGCTGGGCTTGATTACGGTGCAGACGATTATATAGTT
    AAGCCGTTTGATATTGAAGAACTTTTAGCAAGAATTCGTGCAATTTTACGTCGTCAGCCA
    CAAAAGGATATTATCGATGTCAACGGTATTACAATTGATAAGAACGCTTTTAAAGTGACG
    GTAAATGGCGCAGAAATTGAATTAACAAAAACAGAGTATGATTTACTATATCTTCTAGCT
    GAAAATAAAAACCATGTTATGCAACGGGAACAAATTTTAAATCATGTATGGGGTTATAAT
    AGTGAAGTAGAAACAAATGTCGTAGATGTTTATATAAGATATTTACGAAACAAGTTAAAA
    CCATACGATCGTGACAAAATGATTGAAACAGTTCGTGGCGTTGGGTATGTGATACGATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1451 [new locus tag: SACOL_RS07400 ]
  • symbol: ArlR
  • description: DNA-binding response regulator ArlR
  • length: 219
  • theoretical pI: 4.63339
  • theoretical MW: 25497.9
  • GRAVY: -0.331507

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transductionSignal transductionTwo-component systemsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transductionRegulatory functionsDNA interactionsheavy metal response regulator (TIGR01387; HMM-score: 221)
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 113.5)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transductionRegulatory functionsDNA interactionsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transductionSignal transductionTwo-component systemsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Cellular processesCellular processesSporulation and germinationsporulation transcription factor Spo0A (TIGR02875; HMM-score: 57.7)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 32.6)
    Signal transductionRegulatory functionsDNA interactionsPEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 31)
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsputative phage terminase, small subunit, P27 family (TIGR01558; HMM-score: 13)
  • TheSEED:  
    Putative response regulator ArlR 
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 105.7)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 96.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.106
    • Ymax_pos: 35
    • Cmax: 0.108
    • Cmax_pos: 29
    • Smax: 0.149
    • Smax_pos: 28
    • Smean: 0.086
    • D: 0.098
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTQILIVEDEQNLARFLELELTHENYNVDTEYDGQDGLDKALSHYYDLIILDLMLPSINGLEICRKIRQQQSTPIIIITAKSDTYDKVAGLDYGADDYIVKPFDIEELLARIRAILRRQPQKDIIDVNGITIDKNAFKVTVNGAEIELTKTEYDLLYLLAENKNHVMQREQILNHVWGYNSEVETNVVDVYIRYLRNKLKPYDRDKMIETVRGVGYVIR

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3]
    quantitative data / protein copy number per cell: 139 [4]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 14.42 h [5]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]