From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1518 [new locus tag: SACOL_RS07740 ]
  • pan locus tag?: SAUPAN003942000
  • symbol: cmk
  • pan gene symbol?: cmk
  • synonym:
  • product: cytidylate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1518 [new locus tag: SACOL_RS07740 ]
  • symbol: cmk
  • product: cytidylate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 1557146..1557805
  • length: 660
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAGCCATTAATATTGCATTAGATGGTCCAGCTGCTGCCGGAAAAAGTACAATTGCG
    AAACGTGTAGCCAGCGAACTATCAATGATTTATGTCGATACAGGAGCAATGTATCGTGCA
    TTAACATACAAATATTTAAAATTAAACAAAACTGAGGACTTTGCAAAACTAGTTGACCAA
    ACAACATTAGATTTAACTTATAAAGCAGATAAAGGTCAATGTGTCATTTTAGATAACGAA
    GATGTAACAGACTTTTTAAGAAATAATGATGTGACGCAACATGTTTCATACGTTGCATCT
    AAAGAGCCAGTACGTTCATTCGCCGTTAAAAAACAAAAAGAGTTAGCTGCAGAAAAAGGT
    ATCGTAATGGATGGTCGCGATATCGGAACTGTAGTGCTACCAGATGCAGATTTAAAAGTA
    TATATGATTGCATCAGTTGAAGAGCGAGCAGAAAGAAGATATAAAGATAATCAATTAAGA
    GGTATCGAATCAAATTTTGAAGATTTAAAACGTGATATTGAAGCTCGTGATCAATATGAC
    ATGAACCGTGAAATATCACCATTAAGAAAAGCAGATGATGCAGTGACATTAGATACGACA
    GGCAAGTCGATTGAAGAAGTTACTGACGAAATTTTAGCGATGGTGAGTCAAATTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1518 [new locus tag: SACOL_RS07740 ]
  • symbol: Cmk
  • description: cytidylate kinase
  • length: 219
  • theoretical pI: 4.8264
  • theoretical MW: 24594.8
  • GRAVY: -0.435616

Function[edit source | edit]

  • reaction:
    EC 2.7.4.25?  ExPASy
    (d)CMP kinaseATP + (d)CMP = ADP + (d)CDP
    EC 2.7.4.14?  ExPASy
    UMP/CMP kinaseATP + (d)CMP = ADP + (d)CDPATP + UMP = ADP + UDP
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionscytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 243.5)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 42.1)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsadenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 21.3)
    carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 13.7)
  • TheSEED:  
    Nucleosides and NucleotidesPyrimidinespyrimidine conversions Cytidylate kinase (EC 2.7.4.25) 
  • PFAM:
    P-loop_NTPase (CL0023) Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 236.7)
    Cytidylate_kin2; Cytidylate kinase-like family (PF13189; HMM-score: 37.4)
    AAA_18; AAA domain (PF13238; HMM-score: 30.5)
    AAA_33; AAA domain (PF13671; HMM-score: 27.1)
    SKI; Shikimate kinase (PF01202; HMM-score: 23.3)
    AAA_17; AAA domain (PF13207; HMM-score: 19.1)
    AAA_14; AAA domain (PF13173; HMM-score: 15.8)
    AAA_24; AAA domain (PF13479; HMM-score: 14.7)
    ADK; Adenylate kinase (PF00406; HMM-score: 14.7)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.7)
    no clan definedTPX2; Targeting protein for Xklp2 (TPX2) (PF06886; HMM-score: 13)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.157
    • Ymax_pos: 15
    • Cmax: 0.112
    • Cmax_pos: 37
    • Smax: 0.319
    • Smax_pos: 11
    • Smean: 0.226
    • D: 0.184
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKAINIALDGPAAAGKSTIAKRVASELSMIYVDTGAMYRALTYKYLKLNKTEDFAKLVDQTTLDLTYKADKGQCVILDNEDVTDFLRNNDVTQHVSYVASKEPVRSFAVKKQKELAAEKGIVMDGRDIGTVVLPDADLKVYMIASVEERAERRYKDNQLRGIESNFEDLKRDIEARDQYDMNREISPLRKADDAVTLDTTGKSIEEVTDEILAMVSQIK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3] [4]
    quantitative data / protein copy number per cell: 307 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 25.31 h [6]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol. Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]