From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
  • pan locus tag?: SAUPAN004175000
  • symbol: SACOL1645
  • pan gene symbol?: comEB
  • synonym:
  • product: comE operon protein 2

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
  • symbol: SACOL1645
  • product: comE operon protein 2
  • replicon: chromosome
  • strand: -
  • coordinates: 1677599..1678030
  • length: 432
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGGCACAAAGTCATTTGCTAGCATTACGTTCAACTTGTCAAAGATTATCTGTAGGTGCA
    ACGATTGTTAAGGATAATCGTATTATTGCTGGTGGTTATAATGGCTCTGTAGCTGGCGAG
    GTGCATTGTATAGATGAAGGATGTTTAATTGAAGATGGACATTGTATCAGAACGATACAT
    GCAGAAATGAATGCTTTATTACAATGTGCAAAACAAGGTGTATCTACTGAAGGTGCAACA
    ATCTATGTTACTCATTTTCCATGCCTAAATTGTACAAAGTCAATTATTCAAGCAGGTATA
    AAGCGTATCTACTATGCAGAAGATTATCATAACCATGAATATGCAACTAAATTACTCAAA
    CAATCTGGTATTGAATTTAAAAAAATTCCATTTTCACCAGAATATGTTGCTAAATATCTG
    ACTAAAGGTTAA
    60
    120
    180
    240
    300
    360
    420
    432

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
  • symbol: SACOL1645
  • description: comE operon protein 2
  • length: 143
  • theoretical pI: 8.06231
  • theoretical MW: 15763.1
  • GRAVY: -0.093007

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    ComE operon protein 2 (TIGR02571; HMM-score: 270.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersRiboflavin, FMN, and FADriboflavin biosynthesis protein RibD (TIGR00326; EC 1.1.1.193,3.5.4.26; HMM-score: 38.4)
  • TheSEED:  
    DNA MetabolismDNA uptake, competenceLate competence Late competence protein ComEB 
    Late competence dCMP deaminase (EC 3.5.4.12) 
  • PFAM:
    CDA (CL0109) dCMP_cyt_deam_1; Cytidine and deoxycytidylate deaminase zinc-binding region (PF00383; HMM-score: 96.3)
    MafB19-deam; MafB19-like deaminase (PF14437; HMM-score: 63.7)
    Bd3614-deam; Bd3614-like deaminase (PF14439; HMM-score: 14.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.21
    • Ymax_pos: 11
    • Cmax: 0.119
    • Cmax_pos: 44
    • Smax: 0.52
    • Smax_pos: 6
    • Smean: 0.443
    • D: 0.301
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAQSHLLALRSTCQRLSVGATIVKDNRIIAGGYNGSVAGEVHCIDEGCLIEDGHCIRTIHAEMNALLQCAKQGVSTEGATIYVTHFPCLNCTKSIIQAGIKRIYYAEDYHNHEYATKLLKQSGIEFKKIPFSPEYVAKYLTKG

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3]
    quantitative data / protein copy number per cell: 114 [4]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]